Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1028799.3.peg.2086 hypothetical protein [Staphylococcus aureus subsp. aureus VC40]
atggcattaatagtatctagagctatattatttttgattttagcattagcttttggaata
gcgactgtttttcctgaacaaaaattaccattatatatagtattcacattatttgtagca
gttgcgatcgtttcgaatgtatggtttacacatcaaaacgttaaaaagcatatcattaag
tttaacaaatacgtcgcatactttttatcctttgtctcagggttactttacattggattt
gtaatttatacattaactatagggagctatgatgttttaccaattattatatttgcaata
agtatcgtattggttcaaatattagaaaatatactgggaatcagtataaaaaatacgcgt
ctatcaaacaaacagttgaaagtcatctccaagcaacgtgttcagcaatttaaagtcata
tcattaatattagtaagtgtgtctatcgtgttcatttttattgcattaatgcttaaatgg
tggcttttacttgttattagcattattgttttgattattattacagtagcaatgattgtt
tatgaaaaatattatacgactcctgattaa