Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1005551.3.peg.4526 Ketol-acid reductoisomerase (EC 1.1.1.86) [Escherichia coli EC1866]
atggctaactacttcaatacactgaacctgcgccagcaactggcacagttgggcaaatgt
cgctttatgggccgcgacgaattcgccgatggcgcgagctaccttcagggtaaaaaagtg
gtcatcgtcggctgtggcgcacagggtctgaaccagggcctgaacatgcgtgattctggt
ctcgatatctcctacgctctgcgtaaagaagcgattgccgagaagcgcgcgtcctggcgt
aaagcgaccgaaaatggttttaaagtgggtacttacgaagaactgatcccacaggcggat
ctggtggttaacctgacgccggacaagcagcactctgatgtagtgcacaccgtacagcca
ctgatgaaagacggcgcggcgctgggttactcgcatggtttcaacatcgtcgaagtgggc
gagcagatccgtaaagacatcaccgtagtaatggttgcgccgaaatgcccaggcaccgaa
gtacgtgaagagtacaaacgtggattcggcgtaccgacgctgattgccgttcacccggaa
aacgatccgaaaggcgaaggcatggcgatcgctaaagcatgggcggcggcaaccggtggt
catcgtgcgggcgtgctggaatcctctttcgttgcggaagtgaaatctgacctgatgggc
gagcaaaccattctgtgcggtatgttgcaggccggctctctgctgtgcttcgacaagctg
gtggaagaaggcaccgatccggcatacgcagaaaaactgattcagttcggctgggaaacc
atcaccgaagcgctgaaacagggcggcatcaccctgatgatggaccgtctctctaacccg
gcgaaactgcgcgcttacgcgttgtcagaacagctgaaagagatcatggcaccgctgttc
cagaaacatatggacgacatcatctccggcgaattctcctccggcatgatggcggactgg
gccaacgatgataagaaactgctgacctggcgtgaagagaccggcaaaaccgcgtttgaa
accgcgccgcagtatgaaggcaaaatcggcgagcaggagtacttcgataaaggcgtactg
atgatcgcgatggtgaaagcgggcgttgagctggcgtttgaaaccatggttgattccggc
atcatcgaagaatctgcttactatgaatcactgcacgaactgccgctgattgccaacacc
atcgcccgtaagcgtctgtacgaaatgaacgtggttatctctgataccgctgagtacggt
aactatctgttctcttacgcttgtgtgccgttgctgaaaccgtttatggcagagctgcaa
ccgggcgatttgggtaaagctattccggaaggtgcggtagataacgcgcaactgcgtgat
ttgaacgaagcgattcgcagccatgcgattgagcaggtaggtaagaaactgcgcggctac
atgactgatatgaaacgtattgctgttgcgggttaa