Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1005403.3.peg.4124 Branched-chain amino acid ABC transporter, ATP-binding protein LivF [Escherichia coli 93.0055]
tctgttccgcgaaatgacggtaattgaaaacctgctggtggcgcagcatcagcaactgaa
aaccgggctgttctctggcctgttgaaaacgccttctttccgtcgcgcccaaagtgaagc
gctcgaccgcgccgccacctggcttgagcgcattggtttgctggaacacgccaaccgtca
ggcgagtaacctggcctacggtgaccagcgccgtctggagattgcccgctgcatggtgac
gcagccggagattttaatgctcgacgaacctgcggcaggtcttaacccgaaagaaacgaa
agagctggatgagctgattgccgaactgcgcaatcatcacaacaccactatcttgttgat
tgaacacgatatgaagctggtgatgggaatttcggaccgaatttacgtggtcaatcaggg
gacgccgctggcaaacggtacgccggagcaaatccgtaataacccggacgtgatccgtgc
ctatttaggtgaggcataagATGGAAAAAGTCATGTTGTCCTTTGACAAAGTCAGCGCCC
ACTACGGCAAAATCCAGGCGCTGCATGAGGTGAGCCTGCATATCAATCAGGGCGAGATTG
TCACGCTGATTGGCGCGAACGGGGCGGGGAAAACCACCTTGCTCGGCACGTTATGCGGCG
ATCCGCGCGCCACCAGCGGGCGAATTGTGTTTGATGATAAAGACATTACCGACTGGCAGA
CGGCGAAAATCATGCGCGAAGCGGTAGCGATTGTCCCGGAAGGGCGTCGCGTCTTCTCGC
GGATGACGGTGGAAGAGAACCTGGCGATGGGCGGCTTTTTTGCCGAACGTGATCAGTTTC
AGGAGCGCATAAAGTGGGTGTATGAGCTGTTTCCACGTCTTCATGAGCGTCGTGTTCAGC
GGGCAGGCACCATGTCCGGCGGTGAACAGCAGATGCTGGCGATTGGTCGCGCGCTGATGA
GCAATCCGCGTTTGTTGTTGCTTGATGAGCCATCGCTCGGTCTTGCGCCGATTATCATCC
AGCAAATTTTCGACACCATCGAGCAGCTGCGCGAGCAGGGGATGACTATCTTCCTCGTCG
AGCAGAACGCCAACCAGGCGCTGAAGCTCGCTGATCGCGGCTACGTGCTGGAAAACGGCC
ATGTTGTGCTCTCCGATACTGGTGATGCGCTGCTGGCGAACGAAGCAGTGAGAAGTGCGT
ATTTAGGCGGGTAAattatcgataacccggcagctaagttctgccgggttattcgtccgt
atacagacttgtttcaactgaccgggaggattaaaaccagaccacttatttgccacggaa
aggttccctcccatgcattatgccgttgttgtcatgcttgaactgctttgctgtattcac
gcttaccgtaccggacaagagcggtactggatttttatcattttctgttttccggtgatt
ggctgcgtggcgtatttcgtcatagtgatgctgcctgaaacgggcgctgaccgtcacggg
catactttgctgatgcgcctgcaggacaaactcaaccctgagcgccacctgcgcaaatta
accgaagaactggcgattgccgagacgaatcaaaaccattatgcgttggctaatgaactg
gcgcgtctggggcgttatcacgaagctgttccccattatcagcaggcgttaagcgggata
ttcgcccatgaagcggcaatgatgctaagcctgg