Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1005399.3.peg.3867 Threonine dehydratase, catabolic (EC 4.3.1.19) @ L-serine dehydratase, (PLP)-dependent (EC 4.3.1.17) [Escherichia coli 89.0511]
atgcatattacatacgatctgccggttgctattgatgacattattgaagcgaaacaacga
ctggctgggcgaatttataaaacaggcatgcctcgctccaactattttagtgaacgttgc
aaaggtgaaatattcctgaagtttgaaaatatgcagcgtacgggttcatttaaaattcgt
ggcgcatttaataaattaagttcactgactgatgcggaaaaacgcaaaggcgtggtggcc
tgttctgcgggcaaccatgcgcaaggggtttcgctctcctgcgcgatgctgggtatcgac
ggtaaagtggtgatgccaaaaggcgcgccgaaatccaaagtagcggcaacgtgcgactac
tccgcagaagtcgttctgcatggtgataacttcaacgacactatcgctaaagtgagcgaa
attgtcgaaatggaaggccgtatttttatcccaccttacgatgatccgaaagtgattgct
ggtcagggaacgattggcctggaaattatggaagatctctatgatgtcgataacgtgatt
gtgccaattggtggtggcggtttaattgctggtattgcggtggcaattaaatctattaac
ccgaccattcgtgttattggcgtacagtctgaaaacgttcacggcatggcggcttctttc
cactccggagaaataaccacgcaccgaactaccggcaccctggcggatggttgtgatgtc
tcccgcccgggtaatttaacttacgaaatcgttcgtgaattagtcgatgacatcgtgctg
gtcagcgaagacgaaatcagaaacagtatgattgccttaattcagcgcaataaagtcgtc
accgaaggcgcaggcgctctggcatgtgctgcattattaagcggtaaattagaccaatat
attcaaaacagaaaaaccgtcagtattatttccggcggcaatatcgatctttctcgcgtc
tctcaaatcaccggtttcgttgacgcttaa