DNA and flanking Sequence for fig|93062.19.peg.917 from Staphylococcus aureus subsp. aureus COL

length of flanking sequence bp
>fig|93062.19.peg.917 DUF1450 superfamily protein
tcatacgaacatctttatctgatttcgtgcccgcagctaaagcataaaattctggtttca
atccatgaaatggcatacgatcaactaatgtgactgtataatcttgtggtaaagaagtag
ttaaaatgcgtgacatgatacgcatattaccatatccgccgcctaacaaaactaagtttt
tcataatgaagtaccccttttatatgttaatatttactttaattttgaaaagatcaaagt
gcatagatatatttgttaatgaacagttataaaatgcaagtgtctttgattcatcaataa
cccctaaaaaagtaaatatgtatttatatgcttattatatatttttttgaaaatgactac
aaataaatatttgtactaactaaggcactattacataactgggataagaaacatcagttg
ttgctaattgagcacatcatgttaaaataccagttttaaaatgctataatattgtaacaa
atgaaataagaaggtgaagtatgaatccgatcgtagaattttgtctctctaacatggcaa
aaggtggagattatgtttttaatcaactggaaaatgacccagatgtcgatgtgttagagt
atggttgcctgacacattgtggtatatgttcagccgggttgtatgctttagtaaatggtg
atattgttgaaggtgattcgccggaagaattattacaaaatatatatgcacatataaaag
aaacttggattttttaaggaggagttatcatgccaacagttatattaacagaagcagctg
cttacgaagtaaaagatatgcttaaagcaaatgaaatgccagatggctatttaaaaatta
aagtgaatggtggcgggtgcactggtttaacatacggtatgggtgcagaagaagcgcctg
gtgaaaatgatgaagtcttagaatactttggattaaaagtattagtagacaaaaaagatg
cacccgtattaaatggtacgactattgattttaagcaatcattaatgggtggcggtttcc
aaatcgacaatcctaatgcaattgcttcatgtggctgtggtagttcatttagaactgcaa
aagttgcaggtaatcctgaaaattgctaataaaataactttttaatggttaacccaattt
ttgggatacaaattgatatcaataacgattaaggacatatttgattatgtcctatttttg
cgtaaagatattttgttttattaaaaagcttattgaa