DNA and flanking Sequence for fig|93062.19.peg.862 from Staphylococcus aureus subsp. aureus COL

length of flanking sequence bp
>fig|93062.19.peg.862 Thioredoxin
cattgagtttgtaattattatattaagctagtttaaattttttgtgatttatgttttatt
cataccaattttgtgaaatgatacagtgacagatgtttattgattttaaagggtgatgat
gatggctattgtaaataaagtgataattgttgaaggaaaatctgataaaaaaagggtgca
acaggttattgcagaaccagtcaatattatttgtactcatggaacaatgagtatagataa
gcttgatgatatgatagaatcactgtatgataaacaagtttttgtattagccgattctga
tgacgaaggagatcgaattagaaattggtttaaacgttatttgagtgaaagtgaacatat
atttattgataaaacttactgtcaagttgcgaattgccccaaacaatatttggcgcatgt
actttcaaaacatggctttacttgtaagaaagaaacacctcttttaccgaatataaataa
tgaaaggttagttttagtaaatgaataattcattagacatcaaagatgtaactacatttt
atgaggaagacaaacatttaatctttggttatacaccaacgtgtggtacttgtaaggttt
cagaaagaatgttagacattgctaatgaaatattgcagttaccattattgaaaatagatt
taaacttttatcctcagttttgtaaagatatgcaaatcatgtctacgccgattttattgt
tgatgaataaagataaagaagtaaaacgaatttatgcatttaaatcggtgactgatttgt
tagaaaatttaaaatagttattgacgaaattttactaaggtgttaggattaatacaaatt
aaatgatgcgtaaactcttatcgagagtggtggagggatgtgccctacgaagcccggcaa
ccgtcttatatagaaatggtgccaattcacataaagttttaacttttgaagatgagagaa
acaatactactattgctttctcaatttttctatcgatattgagaaagcattttttatttt
attaagcaacacagggaggaatcaacgtgattgaattaaaagaagttgttaaagaatatc
ggactaaaaataaagaagtccttgctgtagatcacgttaatttatcgattcgagcaggat
cgatttatggcgtcattggtttttctggagcaggaaaaagtactttgattcgaatgttta
atcatttagaagcgcctacatcaggtgaagttattatagatggagaccatataggtcaat
tgtccaaaaatggattaagagcaaaaagacaaaaagt