DNA Sequence for fig|93062.19.peg.291 from Staphylococcus aureus subsp. aureus COL

>fig|93062.19.peg.291 Repetitive hypothetical protein near ESAT cluster, SA0282 homolog
atgactttcgaagaaaaactaagtcaaatgtacaatgaaattgcaaatgaaatcagtgga
atgataccagttgaatgggaaaatatatatacaattgcctatgtaactgatcaaggtgga
gaggtcatttttaattatactaaaccaggtagcgatgaattgaattattacacatatatc
cctagagagtataatgtctctgaaaaagtattttatgatttgtggacggatttatataga
ttgtttaagaagttaagagaaacttttaaagaagaagggcttgaaccatggacatcaagt
gaatttgactttacaagcgaaggtaaattaaaagtttcatttgattatattgattggata
aatacagagtttgatcaattaggccgtgaaaactattatatgtataaaaagtttggtgtt
ttaccagaaatggaatacgaaatggaagaagttaaagaaatcgagcaatatattaaagag
caagatgaagctgaactatag