DNA and flanking Sequence for fig|93062.19.peg.2479 from Staphylococcus aureus subsp. aureus COL

length of flanking sequence bp
>fig|93062.19.peg.2479 FIG01107948: hypothetical protein
agaccataaacatcgtacacccttaagaaaacgttttcaacttttatctgttatcaaatc
aaatatttaagtgaaatatttcatatttgtgaaagatttttaaaatggattgtttcaaaa
actacttatgttgtcgttaatatttactaattaactttttactctatatttcaaacagtt
gtgtgacagttttttgataactttttttacatctgaaagtaagtaatatttctaaaaact
tttaatatttatacactttatctttcgagctattttttttttgtttttgtgctgtgttta
taaaaccgcacactatattcaaaaataacttattacacatatatttgcaataagataatt
aaagtaggatattatttttagttttctgataggaatgatgatagtctataggttgaatct
ttacttttttttaaagctaaatttacatcaacttaacaatggttggttatactgaagatg
aaaatatttagtataacttagtggaggcgataaaggtgcaattgagtcattccgttaaag
ttgcaatttctatctatttagcacttatctttataacgttcacttcttatttagtcatta
ttttatatacgagtatgactggacatgatgtatcacatttcgtgttagatagtcagcatt
ctcatcatggatctcttacgcaaaaacatttgagtcttcctgaaatctcatttaaatagt
ttatcctctgtgtttcaacattcatttcccatatcgattcatttatctatcatctagacc
actacatcttagatgatttttttattttctcatttcactctttcttaaaagtcgatataa
tgaattaaatcattatcatacaccgacatattttatgttgttggtgttaagttttaaagg
ggtgagatacttggcgaataatcattcagctttgcgtttaaaaggaattatacttgccat
tgtcggtgcttgtttatggggattaggtggtactgtttctgatttcttgttcaaatataa
gaatattaatgtcgattggtacgtcactgctcgacttgtagtcagtggtgttttcttact
tattatgtacaaaatgatgcaacccaaacgttcaatatttagcgtattccaagatcgacg
tatgttaggcaaattacttatcttcagtatactgggcatgttagtagtacaatatgctta
tatggcatctattaataca