DNA and flanking Sequence for fig|93062.19.peg.2378 from Staphylococcus aureus subsp. aureus COL

length of flanking sequence bp
>fig|93062.19.peg.2378 Teicoplanin resistance transporter, TcaB family => TcaB2
tcaagacggccaaattaaccagcaagtagataatgctaaagaaaatattaaaaacaacca
aaaaactgatgacattattaaaaatttacaaaatcaaatcgacaacttgaagcagcaaga
acaaaacaaagctgattctaagctaactcaattttatcaagaccaaatcaacaaattgac
agaggcaaataatgcacttaaaaacaatgcaagccaaggtaaaattgaaagcatgttaaa
tgatattaatacaaaattcgacagtattaaatctaaattagaaagcttatttaaagatga
caatggtggcgctaattaattattacacctgctttgatgataaacattaattccctatac
tttatctgtatcactacgttattcgtgatgatgcattaagagtatagggattttttatat
aaacttgtattctaactacatacaaatacacacaaaacgtatataatttatataattata
tcatttaaaggagtctgatcatgcaatcaacgaaaaccaaaacgaagcatttttcatttt
tattgctaattacgttaggcgtcatgaccgcttttggcccactaactatagatatgtacg
taccatcattacctaaagtgcaaggtgattttggttctactacatcagaaattcaattaa
cattatcattcacaatgattggtcttgcactaggccaatttatctttggacctttatccg
atgcttttggtcgcaaacggattgctgtatccattttgatcattttcattttggtatcag
gtttgtctatgtttgttgatcaattgccattattcttaactttacgatttattcaaggtt
taactggtggtggcgtcatcgtgattgcaaaagcctctgctggtgataaatttagtggca
acgcactcgctaaatttttagcatctttaatggtagttaatggcatcatcactattcttg
caccattagccggtggattagctttatccgtagcaacatggcgttctattttcacaattt
taactattgtggcactcatcattttaattggcgtcgcttctcaattacctaaaacatcta
aagatgaattaaagcaggtgaattttagtagcgtcattaaagattttggaagtcttttga
aaaaaccagcatttattattccaatgctattacaaggtttaacttatgtaatgctattta
gttattcatctgcatcgccatttattactcaaaaattgtataatatgacaccccaacaat
ttagtatcatgtttgctgttaacggtgtaggtttaatcattgtcagtcaagtcgttgctt
tattagtagaaaaattacatcgccacatattattaatcattttaactattatacaagtgg
taggtgttgctttaattatcctgacacttacattccatttaccactttgggtcttactca
tcgcattcttcttaaatgtgtgtcctgtgacgtcaattggaccgcttggtttcacaatgg
ctatggaagaacgaacaggtggcagtggtaacgcatcaagtttacttggcttattccaat
ttatcttaggtggcgctgttgcaccattagttggcttaaaaggcgaatttaatacatcac
catatatgattattatcttcattacagccattctattagtcagtctacaaatcatttact
ttaaaatgattaaaaagcaacatgtcgcataacacttcaacataattagaaccctagcaa
agatatctatctttgtcagggttcttctttatgaattatgagatcgaatcttcaactaaa
attacgccttcatagcaaggacatttctattcaatcaccctttaacaggcatccaaattt
ctgtaatatatttttcacttgtagtatcaccatcctgatacaactcaaaaaatggtgctg
attttaccgtatctgcttgatattgatgtatgtagtgatgaacctcttccattttttgtt
gaactgctttaggtactgcgccctgtgcttcaaataccatatactttgaacttgctaatg
ttatgacatcatatttttcaatatcagcactattatctccggtaactgcaatcatatatg
acatcttaccgtctaattcaggtatacataagccaagtatcccggctaaatcaccattat
tttttaactgtaaatccgcaattactccctcttgataacatctttgccaaaa