DNA and flanking Sequence for fig|93062.19.peg.2265 from Staphylococcus aureus subsp. aureus COL

length of flanking sequence bp
>fig|93062.19.peg.2265 Hypothetical protein SAV2327
tgcaaatagattaggtttgtatgaagcttttaattgaacaacataatattaatttagtta
cttcaatccattaaattaaaatgaattggtgaagtgtattttaaatagtcggtaaaggtg
tgtatctttatcggcttattttaatactctgtcataaggagcgtttgctcagggtgtgga
ttataagttttaagcagaataaactttcttaatgaggatgtcaggacaacaacgaaaaag
ttaaaaactgttgcgggattgggtttagggacggttagtggaagaaagttaaattcatta
acaagtgaaatgcctaaggctagatattaaacgtcagaacggacaaagaataataggata
tgttttcaattaaatagcgaagtatttatatgttaagatgatgtaaattacatagaaacg
ctacccgtagaagtactgatcatagaaacgctgataaacgtaaatttgcaaactcgatat
taaacaaaggggttgttattatggcattaatagtatctagagctatattatttttgattt
tagcattagcttttggaatagcgactgtttttcctgaacaaaaattaccattatatatag
tattcacattatttgtagcagttgcgatcgtttcgaatgtatggtttacacatcaaaacg
ttaaaaagcatatcattaagtttaacaaatacgtcgcatactttttatcctttgtctcag
ggttactttacattggatttgtaatttatacattaactatagggagctatgatgttttac
caattattatatttgcaataagtatcgtattggttcaaatattagaaaatatactgggaa
tcagtataaaaaatacgcgtctatcaaacaaacagttgaaagtcatctccaagcaacgtg
ttcagcaatttaaagtcatatcattaatattagtaagtgtgtctatcgtgttcattttta
ttgcattaatgcttaaatggtggcttttacttgttattagcattattgttttgattatta
ttacagtagcaatgattgtttatgaaaaatattatacgactcctgattaatttatgattg
acgtactaaggattatcttgtaacgtaaacgtaaataagcatcacttatctagagaggtg
gagggactggccctatgaagcctcggcaacatctcgaatgtgccaattccagtaaccgta
atggtttgaagataagcaggtaaagcacatgaaaacctctttcttcatcgtttgtgagaa
agaggtatttttaattggaaagcaggtaaaaaggatggaagtacataaaaagagcaatgc
ttgggcattattccccttgttattatttgtggcgttgtttttaggcgtaggtattatcac
aggtgattttacttcaatgccattaaatgttgcaattacgataacggtaattgtggcgtt
attaatgaatcgaaaagaatcatttgctaaaaaagttgaggtcttcacgaaaggtgcagg
ccattcaaacattgttttaatgatgttgatttttattttagcaggtgcattttcaaatac
agctgaaaaa