DNA and flanking Sequence for fig|93062.19.peg.1580 from Staphylococcus aureus subsp. aureus COL

length of flanking sequence bp
>fig|93062.19.peg.1580 Cytidine deaminase (EC 3.5.4.5)
cttttgaacgagaattaggatttttagcattacatggatttttgcatctattaggttatg
atcatatgactgaagcggatgaaaaggaaatgtttggtcgacaagatacaatattaaacg
catatggattaacacgagactaattatgaaaaggtttaaatatgcacttgatgggctgaa
aatcttaattcaaaaagactataaatttcttttacatgtgtttgcaatgattgttgctat
tgtctttggtctcgtactaaatattaatcggattgagtggatatttatactcattgctat
tgcattagttctcactgttgaagctttaaacactgctattgaatatgttgtcgatttagt
gaccgttgaatatcatgatttagctaaatacgctaaagatattgcggcttttagtgtact
tatagtttcaatattagcatttattataggtttaatagtatttttaccacattttatagc
gttattttagggaggcatatatgagttatcaacctcattattttcaagaagttagaaaag
cacaacaagaatcatattcgccatacagtcaatttaaagtaggggcttatttaaaaacga
aagacggtagaactttttatggtaccaatgtagaaaatgcttcttatccattatcgatat
gtgctgaacgagctagtttggtatcggcaatttctcaaggatacagaccaggtgattttg
aatcaataactgtaaccgtagatgcagataaaccgtcatcaccttgtggtgcatgtcgtc
aagttttgaaggaattatgtgatgatgatatgcctgtgtatatgacaaatcataaaggag
atatggttatgatgacagtcgcagagttactaccatttggattttcaggaaaggatttag
aataaatgacagaacataaatcaggatttgtttcaattataggtagaccaaatgtaggaa
agtcaacatttgttaatagagtgatcggccataaaatagcaatcatgtccgataaagctc
aaacaactagaaataaaattcaaggtgttatgacaagagatgacgcgcaaattatattca
ttgatacgccaggtattcataaacctaaacacaaattaggtgactatatgatgaaagtcg
ctaaaaatacattatctgagatagatgcaatcatgtttatggttaatgccaatgaggaaa
ttggacgaggcgatgaatatattatagaaatgttgaaaaatgttaagacaccagtatttt
tagtattaaataaaatagatttagtgcatccagatgaattaatgccaaagattgaagaat
atcaaagttatatggactttacagagattgtacctatttcagcattagaagggctaaatg
tcgatcattttattgatgttttaaa