DNA and flanking Sequence for fig|93061.5.peg.98 from Staphylococcus aureus subsp. aureus NCTC 8325

length of flanking sequence bp
>fig|93061.5.peg.98 Replication initiation protein, topisomerase
aaaaattattgaattatttaaaagttgatgaaacatttttgaatcatctagcaggtatta
atttaaaactctttaaggattatgttaatgaaaatagagaatataatataacgaatctat
ataaataaggcaccaatatttaaacctcgagctgaaaagatcatcatttcagttcgaggt
tttttattttatcctctttgtatgggtattcttttacttgaaatttgttttcctgttttt
ttattgtaaatttttattacatagtatcctaagttatatcctgacatttgttctccagta
tttttagttttttagtaggaacataatggtatttttttgctgttagtggaacatattttt
tagtgttttgaatttcgtttcatccatttgtaaaactggatactctaatatccggtaata
gccggttaaatcgacataggatgtcactagctattccaaaattgtcttttgacgctataa
cgattgttgggaatcttagcatgtctaacgcagagagactttcacattttatgagtacta
atcctgaaattcggctttgggatattttacaaacaaactttaaagctaaagctcttaaag
aaaaagtttatattgaatatgacaaaataaaagcaactctttggaatagacgtagtatgc
gcgttgaatttaatcctaataagctttcgcatgatgaagtgctttggttaaaacaaaata
tcatcagttatttggacgatgttagttttacgagattagatttggcttttgattttgaat
ttgatttaaatgactattatgcattgtcagataagtcggtaaagaaaactatattttatg
gacgtaatgtaaaaccagaaacaaaatattttggtgtgcgtaatagtgataggtttattc
ggatttataataaaaacaagaacgtaaagataatgcagatgttgaaattgattcaacatt
tctatggcgtgtggaaattgaattaaaacgagatatggttgattgttggaaagattgttt
tgatgatttgcatattttaaaaccgaatttaaaaatgattgaaaatatacaagaacgagc
aatgcttcatttattaactcacgaagaagaggaatggggaaatttagaaagacgtactaa
aaataaatatagagataagttgaaaaatatagcgtctattgatttgacagatttaatgaa
aatatctttaagaggaaatgaaaaccaattgcaaaaacaaatcgacttttggttgaatta
attattataactaaagaactatgttcacttatgctcatctacttaaaataagtatttttt
tgttggtttttaaaagtagttgaaatgtttataataatattgaaagatatttctgttttc
cttttgaataataaacttaaaagagaatataaaataatgcttattaaaattaggggtgga
aatatgaaaagagatttttttgaaaagtggtcgtttattttaaatt