DNA and flanking Sequence for fig|93061.5.peg.201 from Staphylococcus aureus subsp. aureus NCTC 8325

length of flanking sequence bp
>fig|93061.5.peg.201 Sorbitol dehydrogenase homologue (EC:1.1.1.14)
ttccagcagcacgacaaggtttggatattttacgcaaaaaaggtttctacagtcaaatag
gtatttttaaggatgctgaaattccatttgatatggaaaaagtgattcaaaaagaaataa
cagttgttggtagtagaagtcaaaagccagcagattgggaaccttcattgcaacttatgg
cggatggtttagtaaatgctgaagctttggtgacaaaaatatatgatatttcgaaatggg
acgaggcgtatcaacatttaaaatccggcgaaggtattaaagcattacttaagccgctcg
atttagatgaaaatgaaggagagaattaatatggtagaatcaatgctaacttttatgctt
gggccattaagacaaatcactgatttttatatggaacatttactcgtaagtaattccatt
gtcattgcaggttattttgcgacaggtatttttaaaaagaaaaaagttgtgaattaaatc
aaatttgaggtgatttacaagtgaaagcattgaaattatatggcgtggaagatttacggt
atgaggataatgaaaagccagtcattgaaagtgcgaatgacgttattattaaagtacgag
cgactggcatatgtggttcagacacgtcacgatacaaaaaaatggggccatacattaaag
gtatgccatttggtcatgaattttcaggtgtagtagatgccattggaagtgatgttacgc
atgttaatgtgggcgacaaagtgacaggttgcccagcaataccttgttatcaatgcgagt
attgtttaaaaggtgaatatgcacgatgtgaaaagttattcgtcattggctcatatgaac
ctggatcgttcgcggaatatgtcaaattgccagcgcaaaatgttttaaaggttccagaca
atgttgattacattgaagcagcaatggttgagccatcagccgttgttgcgcatgggtttt
ataaatcgaatatacaacctggtatgactgttgcagtaatggggtgtggcagtataggtt
tgttagctattcaatgggcacgaatatttggtgctgcacatatcatcgctatagatatag
atgcgcataaactagatattgcaacatcattgggcgcacatcaaacaatcaattcaaaag
aagaaaatcttgagaaattcatcgaaaatcattacgccaatcaaatcgatttagctatag
aatcatcaggtgctaaagttacgattggtcaaatattgacgctacctaaaaaaggtggcg
aggtggtattactcggaataccatatgatgatattgagattgatcgcgttcattttgaaa
aaattctgcgtaacgagttgacagtatgtggctcttggaactgtttgtccagtaattttc
cgggcaaagagtggacggcaaccttacattatatgaagacgaaagatattaatgtaaagc
ctattatttctcattttttaccgttagaaaaaggcccggagacatttgataaattagtta
acaagaaagaacgatttgataaagtcatgtttacgatttattagtatgcacctttgagga
cgaaaacgctggtatagttatagctatgaaagtgcgaatgccgtctggtctatagatact
atcgaaataattcatcttcgaatatacgttgataaatagccggtttacttgtgtgaaata
tgcttgtgaatcggttgttttgcattttgtatacttaaaatgagatggcaatatttgata
atttttaaagtgaaaatcaagtacagccacttaataagataaatttattataatatatgg
taaaatgatggcagtaataatgaatttgaaaaagagtaaacattaatacctttaacaatt
taatatcgtcagagttaatgattaactgcatggcaaaacaacttagaatggtcagttaca
aaaatacatttttataaaaaattatcacactattgtgacaactatctttggattaataaa
agaggcaagtgagcaataggttaggcttatgtgcgggcataggtcagtaatgtataaatg
gaaa