DNA Sequence for fig|93061.5.peg.1730 from Staphylococcus aureus subsp. aureus NCTC 8325

>fig|93061.5.peg.1730 Transaldolase (EC 2.2.1.2)
atggctaaactaaatgtagaagtatttgcggacggtgcagatattgaagaaatgaaagca
gcttataaaaacaaacaagtggatggttttacaacaaatcctagtttaatggctaaagcg
ggcgtaacagattacaaagcttttgctgaagaagctgtgaaagaaattccagatgcttca
atttcatttgaagtatttgcagacgatttagaaactatggaaaaagaagcagcaatttta
aaacaatatggcgaaaatgtatttgttaaaattcctattgtaaatacaaaaggtgaatca
acgattcctttaattaaaaaactttcagctgacaatgtgagattaaacgttacggctgtt
tacacaattgaacaagttaaagaaataactgaagcagtaactgaaggtgtgccaacatat
gtttcagtatttgcaggacgtattgcagatacaggcgtagatccattaccattaatgaaa
gaggctgtaaaagttacgcatagtaaagacggcgttaaattattatgggcaagttgccgc
gaattattcaatgtgattcaagctgatgaaattggtgcagatattattacatgcccagca
gatgttgtgaaaaaagtgaatacaaacttaggtcgcgatattaacgaattatcagtagat
acagttaaaggctttgcgaaagatattcaatcttcaggtctttctattctataa