DNA and flanking Sequence for fig|93061.5.peg.1471 from Staphylococcus aureus subsp. aureus NCTC 8325

length of flanking sequence bp
>fig|93061.5.peg.1471 Arginine pathway regulatory protein ArgR, repressor of arg regulon
attgatgaacaattcaatacaaaacacttattagaaatcgttgatttattttatagcagg
gatcactaaaagcaaatatatcgattagcaacaattgtaaagtttgaaatgtctcaaaag
gcatattcaactgacgttgtttgttaatcgatttttctcatgttgaaacttaaaattatg
ttgaagactttcatttaaaaaatagaattttcaatttctatacgacaatattcgtatctg
tgatatcaatgtgattttaattaaatatgttcaaacaattgacgcttattaaatctaata
attagcaagtttattacacatatattcatttttatacatattttaagcaattgttatgcg
taatatgaaaaatatttataaatagataaccaagatagataaaccatgtttacccttttt
acgtaaaggtgtttagtagtcgtaaatcagtgcatgtgttaaaataaatgtataaatatt
cgtaatcagaggtgtttactgtgcccaaaaaatcggttaggcatataaaaattagagaaa
ttatttcaaatgaacagatagagacacaagatgaattagttaaacgattaaacgattatg
atttaaatgtcactcaagcaactgtttctcgtgatattaaagaactacaacttattaaag
tacctataccttcaggtcaatatgtttatagtttaccaaatgatagaaaattccatcctt
tagaaaaattgggacgttatttaatggattcctttgttaatatagatggtactgataatt
tacttgttctaaaaacattacctggtaatgcacaatctattggagctatattagaccaaa
tcaattgggaagaagtactaggcacaatttgtggtgatgatacttgtttaattatttgtc
gaagcaaagaggcaagtgatgaaatcaagtcaagaattttcaatttgttataaggatgcg
atgagtttatgttacaaaccttatcaatcaagcaatttgctattattgaagaattagaaa
ttcaattttctgatggtttaactgttttaagtggtgaaacgggttcaggtaagtcaatta
ttatagatgcaattggacaattaattggaatgagagcttcatctgattttgtaagacatg
gtgaaaaaaaggctgtcatcgaaggtatatttgatattgacgagagtaaagatgctatac
atatattgaaaaatatggatattgatgtagatgaagattttttattagttaaacgggaaa
ttttcagctctggtaaaagtctttgtaaaattaataatcaaacagttactttacaagatt
tacgaaaagttatgcaagaattattagatattcatggccaacatgaaacgcagtctttgt
tgaaacaaaaataccatttaacattattggataattacgcagaatcacgttatcaagatt
tgttggataaata