DNA and flanking Sequence for fig|93061.3.peg.954 from Staphylococcus aureus subsp. aureus NCTC 8325

length of flanking sequence bp
>fig|93061.3.peg.954 hypothetical protein
aattataaaaaaagcatataatattataaataatatgtagtggagtagaacaacatgtat
aaacaacttgaaaaacttattacactgactaacaatgacttaaacttagtgaatagaaga
tttggacaacgcacggatatcacatctgaacagctagaacttctccgtattttatttaat
tacgatcgcttatcacagtatgatttgacgatgaagattagcagggaacaatctatagtt
tcaaggtggattaagaaattagttttgaaagggtacatcacaagtcaacaatctagcgaa
gatttaagatgtaaagaattaattttgactgatcaagcacgtacattaatttcacaaata
aataatgcacgttgcgaattgattgaagcaagatgtcaatgtttatcggaagtcgaatta
gacaatttaaatcaattacttgataagttaaatcaacgacgcatatcgttgtaacacgac
aatagcaaacacataatttagtgtcgttgtgcacacaacaaaaattgaatcatgaattac
aagcaaaagtagcggtgattgttaaaattgatggtaaacaatcaccgctatttttgcttg
tgtatgtataaaaaagggatcaaaggtcatcccccatgattgatagtgggggatgacttt
tgatcctatgttcatgttgcttatttatattgtgggatgtcgaagtatttgccgacttcg
ccaattttatcatagtagcctttgatgattttagcattgatgttagcccaatctacatct
gtagcatattggtgtgttcctggatgtgcaggattccatctcattttgtaaagtgtattt
tgaccagcttttacatatgagttgccgatgaatttagcaccaccaacgattgcttttgat
actgtgtcccaaccagcttgtttagcatatttaataccttcacgtaaaggatcgttatca
tatgcagcaataccaaatacgttatggtatttcgtgtttgagttagttacaactttgttg
ttcactacatctgcacctttcgctaattgagaagtaccgttacctgtttctaatagggca
tgtgagataagataaacttcattaatgccat