DNA Sequence for fig|868201.3.peg.4262 from Escherichia coli DEC14A

>fig|868201.3.peg.4262 Acetolactate synthase large subunit (EC 2.2.1.6)
atggcaagttcgggcacaacatcgacgcgtaagcgctttaccggcgcagaatttatcgtt
catttcctggaacagcagggcattaagattgtgacgggcattccgggcggttctatcctg
cctgtttacgatgccttaagccaaagcacgcaaatccgccatattctggcccgtcatgaa
cagggcgcgggatttatcgctcaggggatggcgcgcaccgacggtaaaccggcggtctgt
atggcctgtagcggaccgggtgcgactaacctggtgaccgccattgccgatgcgcggctg
gactccatcccgctgatttgcatcaccggtcaggttcccgcctcgatgatcggcaccgac
gccttccaggaagtggacacctacggcatctctatccccatcaccaaacacaactatctg
gtcagacatatcgaagaactcccgcaggtcatgagcgatgccttccgcattgcgcaatca
ggccgcccaggcccggtgtggatagacattcctaaggatgtgcaaacggcagtttttgag
attgaaacacagcccgctatggcagaaaaagccgccgcccccgcctttagcgaagaaagc
attcgtgacgcagcggcgatgattaacgctgccaaacgcccggtgctttatctgggcggc
ggtgtgatcaatgcgcccgcacgggtgcgtgaactggcggagaaagcgcaactgcctacc
accatgactttaatggcgctgggcatgttgccaaaagcgcatccgttgtcgctgggtatg
ctggggatgcacggcgtgcgcagcaccaactatattttgcaggaggcggatttgttgata
gtgctcggtgcgcgttttgatgaccgggcgattggcaaaaccgagcagttctgtccgaat
gccaaaattattcatgtcgatatcgatcgcgcagagctgggtaaaatcaagcagccgcat
gtggcgattcaggcggatgttgatgacgtgctggcgcaattgatcccgcaggtggaagcg
caaccgcgtgcagagtggcaccagttggtagcggatttgcagcgcgaattcccgtgtcca
atcccgaaagcgtgcgatccattaagccattacggcctgatcaacgccgttgccgcctgt
gtcgatgacaatgcgattatcaccaccgatgtgggtcagcatcagatgtggaccgcgcaa
gcttatccgctcaatcgcccacgccagtggctgacctccggtgggctgggcacgatgggt
tttggcctgcctgcggcgattggcgcggcgctggcgaacccggatcgcaaagtgttgtgt
ttctccggcgacggcagcctgatgatgaatattcaggagatggcgaccgccagtgaaaat
cagctggatgtcaaaatcattctgatgaacaacgaagcgctggggctggtgcatcagcaa
cagagtctgttctacgagcaaggcgtttttgccgccacctatccgggaaaaatcaacttt
atgcagattgccgccggattcggcctcgaaacctgtgatttgaataacgaagccgatccg
caggctgcattgcaggaaatcatcaatcgccctggcccggcgctgatccatgtgcgcatt
gatgccgaagaaaaagtttacccgatggtgccgccaggtgcggcgaatactgaaatggtg
ggggaataa