DNA Sequence for fig|656374.3.peg.4175 from Escherichia coli E1520

>fig|656374.3.peg.4175 Leucine-specific ABC transporter, substrate-binding protein LivK
atgaaacggaatgcaaaaactatcatcgcagggatgattgcactggcaatttcacacacc
gctatggctgacgatattaaagtcgccgttgtcggcgcgatgtccggcccgattgcccag
tggggcgatatggaatttaacggcgcgcgtcaggcgattaaagacattaatgccaaaggg
ggaattaagggcgacaagctggttggcgtggaatatgacgacgcctgcgacccgaaacaa
gccgttgcggtcgccaacaaaatcgttaatgacggcattaaatacgttattggtcatctg
tgttcttcttctactcaacctgcgtcagatatctatgaagatgaaggtattctgatgatc
tcgccgggagcgaccaatccggaactgacccaacgcggttatcaacacatcatgcgtact
gccgggctggactcttcccaggggccaacggcggcaaaatacattcttgagacggtgaag
ccccagcgcatcgccatcattcacgacaaacaacagtatggcgaagggctggcgcgttcg
gtgcaggacgggctgaaagcggctaacgccaacgtcgtcttcttcgacggcattaccgcc
ggggagaaagatttctccgcgctgatcgcccgcctgaaaaaagaaaacatcgacttcgtt
tactacggcggttactacccggaaatggggcagatgctgcgccaggcccgttccgttggc
ctgaaaactcagtttatggggccggaaggtgtgggtaacgcatcattgtcgaatattgcc
ggtgatgctgccgaaggcatgttggtcactatgccaaaacgctatgaccaggatccggca
aaccagggcatcgttgatgcgctgaaagcagacaagaaagatccgtccgggccttatgtc
tggatcacctacgcggcggtgcaatctctggcgactgcccttgagcgtactggcagcgat
gagccgctggcgctggtgaaagatttaaaagctaacggtgcaaacaccgtgattgggccg
ctgaactgggatgaaaaaggcgatcttaagggatttgattttggtgtcttccagtggcac
gccgacggttcatccacggcagccaagtga