DNA and flanking Sequence for fig|585154.3.peg.2415 from Staphylococcus aureus subsp. aureus EMRSA16

length of flanking sequence bp
>fig|585154.3.peg.2415 putative esterase
ttaaaatttttaatgccatcaaaatttacagattctttggtgaagacaatattaaaaatg
ggttgtttccacatgctgtatccagcgattgcggttaatataacaacaatgatttgaata
atcatgcttaccaatgaacgttttttcttaccatatcgcttaccacgatgaatattcggt
tgttgaaatgtctcatcaaatggttctaatcgttgatttggatttgtcatacaaggcacc
tccgtataaagttcttttctttacttatcaatatgtctagttgtctgttataatgatgaa
aaatcactgttcaattgtagtcttaaatttgaaagtgaaaaagaaaatatcttctacatt
atatactttttttggcaaagaatgtaggggatagacaatcattggatacataaaatatat
aaaggtaggttaagacattgattagaaaccgtgttatgaatagcgttgtcaataaatatt
tgcttcacaatcgctcgattatgtttaaaaatgatcaagatgttgaaagatttttttata
aaagagaaattgaaaatagaaaaaaacataagcagccttcaacattaaatgttaaagcaa
atttagaaaaattatcattggatgatatgcaagtctttcgctttaatttcagacatcaaa
ttgataagaaaattttatatattcacggtggattcaatgcactacaaccatcaccgttcc
attggagattgttggataaaatcactttaagtacattatatgaggttgtactgcctatct
atccaaagacaccagagtttcatattgacgacactttccaagcgatacaacgtgtttatg
atcaattagtatctgaagtaggccatcaaaatgtcgtagtcatgggtgatggttcaggtg
gtgcactggcattatcctttgtacaatctcttttagacaatcaacagccattaccgaata
aattgtatttaatctcaccaattttagatgcaacactatctaataaagatatttcggatg
ctttaatcgaacaagatgcggttctaagtcagtttggtgtcaatgagattatgaaaaaat
gggcgaatggcctaccattaacagataagcgcatatcaccaattaatggcacaatagaag
gattaccaccagtttatatgtttggtggtggacgtgaaatgacacatcctgatatgaagc
tgttcgaacaaatgatgttgcaacatcatcaatacattgagttttatgattatcctaaga
tggtacatgattttccaatttatccaattagacaatcacataaagctattaaacaaattg
ccaaatcgatagatgaggatgtaacacaaaacaactaataacatataaatgacccagtta
cgatttcatggtagaagatatttaacatgaaaacgcaactgggttttgtttttgaaaata
tagcaaggattatatagactaattgttaatgagcttctgagtgaaaatcaccaataagtg
tattgatatgtgtgatgataaagtattgccctttaatttgataaaattgatctaaaaaat
tatcgaattgacgtggaatatcactaagttctgcaaagttagctgttttatcataattgc
gatgagcaacctcattttgaaatttatcataatgttctaggaaatgttgatcttcaagct
gttgttccacaatagtcataatattatcgatagcttgcttttgtccttgaacataagcca
tatgcacgccacgcttaagtaactgatttgctggtccgttaatgtataaccctttttgtg
catttaattctgttaattcaaacttaacatcatctaataaatctagtagttcgatatg