DNA Sequence for fig|585151.3.peg.1732 from Staphylococcus aureus subsp. aureus C427

>fig|585151.3.peg.1732 Hypothetical SAV0788 homolog in superantigen-encoding pathogenicity islands SaPI
atgaataatgaacaaaaagaagtgattaaagatatttatagcagtttggaatcagtagct
aataacaaatcagaggtatacatccatgaatttaaatgtggtgagaaagaacggacagag
acagtaaaccgtgagcaacacttacaagcgattatcgagtggacattgcaacaaatagaa
aataattttgaatttgaagaggagaatgaataa