DNA Sequence for fig|553583.3.peg.1244 from Staphylococcus aureus A9635

>fig|553583.3.peg.1244 putative esterase
atgtttaaaaatgatcaagatgttgaaagatttttttataaaagagaaattgaaaataga
aaaaaacataagcagccttcaacattaaatgttaaagcaaatttagaaaaattatcatta
gatgatatgcaagtctttcgctttaatttcagacatcaaattgataagaaaattttatat
attcacggtggattcaatgcactacaaccatcaccgttccattggagattgttggataaa
atcactttaagtacattatatgaggttgtactgcctatctatccaaagacaccagagttt
catattgacgacactttccaagcgatacaacgtgtttatgatcaattagtatctgaagta
ggccatcaaaatgtcgtagtcatgggtgatggttcaggtggtgcactggcattatccttt
gtacaatctcttttagacaatcaacagccattaccgaataaattgtatttaatctcacca
attttagatgcaacactatctaataaagatatttcggacgctttaatcgaacaagatgcg
gttctaagtcagtttggtgtcaatgagattatgaaaaagtgggcgaatggcctaccatta
acagataagcgcatatcgccgattaatggcacaatagaaggattaccaccagtttatatg
tttggtggtggacgtgaaatgacacatcctgatatgaagctattcgaacaaatgatgttg
caacatcatcaatacattgagttttatgattatcctaagatggtacatgattttccaatt
tatccaattagacaatcacataaagctattaaacaaattgccaaatcgatagatgaggat
gtaacacaaaataactaa