DNA and flanking Sequence for fig|451515.3.peg.8 from Staphylococcus aureus subsp. aureus USA300_FPR3757

length of flanking sequence bp
>fig|451515.3.peg.8 Replication initiation protein, topisomerase
agtaagtatgtacttggtgttttagtagttttaactgtttaccagataatacaaatgctt
aaataaaaaaagacttgatctgattagaccaagtcttttgatagtgttatattaataaca
aaataaaaaggagtcgctcacgccctgaccaaagtttgtgaacgacatcattcaaagaaa
aaaacactgagttatttttataatcttgtatatttagatattaaacgatatttaaatata
catcaagatatatatttgggtgagcgattccttaaacgaaattgagattaaggagtcgat
tttttatgtataaaaacaatcatgcaaatcattcaaatcatttggaaaatcacgatttag
acaatttttctaaaaccggctactctaatagccggttggacgcacatactgtgtgcatat
ctgatccaaaattaagttttgatgcaatgacgatcgttggaaatctcaaccgagacaacg
ctcaagccctttctaaatttatgagtgtagagccccaaataagactttgggatattcttc
aaacaaagtttaaagctaaagcacttcaagaaaaagtttatattgaatatgacaaagtga
aagcagatagttgggatagacgtaatatgcgtattgaatttaatccaaacaaacttacac
gagatgaaatgatttggttaaaacaaaatataataagctacatggaagatgacggtttta
caagattagatttagcctttgattttgaagatgatttgagtgactactatgcaatgtctg
ataaagcagttaagaaaactattttttatggtcgtaatggtaagccagaaacaaaatatt
ttggcgtgagagatagtaatagatttattagaatttataataaaaagaaagaacgtaaag
ataatgcagatgctgaagttatgtctgaacatttatggcgtgtagaaatcgaacttaaaa
gagatatggtggattactggaatgattgctttagtgatttacatatcttgcaaccagatt
ggaaaactatccaacgcactgcggatagagcaatagtttttatgttattgagtgatgaag
aagaatggggaaagcttcacagaaattctagaacaaaatataagaatttgataaaagaaa
tttcgccagtcgatttaacggacttaatgaaatcgactttaaaagcgaacgaaaaacaat
tgcaaaaacaaatcgatttttggcaacatgaatttaaattttggaaatagtgtacatatt
aatattactgaacaaaaatgatatatttaaactattctaatttaggaggatttttttatg
aagtgtctatttaaaaatttggggaatttatatgaggtgaaagaataatttacccc