DNA Sequence for fig|451515.3.peg.2564 from Staphylococcus aureus subsp. aureus USA300_FPR3757

>fig|451515.3.peg.2564 YefM protein (antitoxin to YoeB)
atgattatcactagccctacagaagcgagaaaagatttttatcaattactaaaaaatgtt
aataataatcacgaaccaatttatattagtggcaataatgccgaaaataatgctgtgatt
ataggtttagaagattggaaaagtatacaagagacaatatatcttgaatctactggtaca
atggacaaagtaagagaaagagaaaaagataatagtggtacaacaaatatagatgatatt
gattgggataatctttaa