DNA Sequence for fig|451515.3.peg.2303 from Staphylococcus aureus subsp. aureus USA300_FPR3757

>fig|451515.3.peg.2303 Truncated cell surface protein map-w
atgaaactaaaatcatttgttactgccactttagcattgggattattatcaacggtcgga
gctgcattaccgagtcacgaagcatctgcagatagtaataacggctataaagaaatgact
gtggatggttatcacactgttccttacacaatttcagtagatggtattactgcattacat
cgaacttactttatcttcccagaaaataaaaatgttctttatcaagaaattgacagtaaa
gtaaaaaatgaattagcttctcaacgtggtgttacaacagaaaaaattaataatgcccaa
acagcaacttatacgcttactttgaatgatggtaataaaaaagtagtgaatctaaagaaa
aatgacgacgctaaaaattcaattgatccaagtacaatcaaacagatacaaattgtagtt
aaataa