DNA Sequence for fig|451515.3.peg.2066 from Staphylococcus aureus subsp. aureus USA300_FPR3757

>fig|451515.3.peg.2066 Bacteriophage
atggtagtaaaacaagcaagtgcgccgaaagcgtattttaacattactggtttaggtttc
gctaaattaacaaaagaaggcgcaaagctagaatatagcgatattacaaaaactagagga
ttacaaaaaatcggtgttgaaactggaggagacttgaaaacagcatatgctgatggtggt
ccaatcgaatcagggaacacagacggagaaggtaaaatttcgttacaaatgcatgctttc
cctaaagagattcgcaaaatagtattcaatgaagagtatgatgaatacggtgtttataaa
gaaactcaaggtaaacaaaacaactatgtagcaatttggttcagacaagagcgtcgagac
ggcacatttagaacggttttattacctaaagtcatgtttacaaatcctaaaatcgatggc
gaaacggctgagaaagattgggatttctcaagcgaagaggttgaaggtgaggcacttttc
cctttaattgataataaaaagtcagtacgtaaatatatctttgattcagcaaacatgaca
aatcatagtggaaatggtgaaaaaggcgaagaggctttcttaaagaaaattttaggcgaa
gaatatactggaaacgtgacagaggataacggcgaaactttgtaa