DNA Sequence for fig|451515.3.peg.2020 from Staphylococcus aureus subsp. aureus USA300_FPR3757

>fig|451515.3.peg.2020 Nitric-oxide synthase (flavodoxin) (EC 1.14.14.47)
atgttatttaaagaggctcaagctttcatagaaaacatgtataaagagtgtcattatgaa
acgcaaattatcaataaacgtttacatgacattgaactagaaataaaagaaactgggaca
tatacacatacagaagaagaacttatttatggtgctaaaatggcttggcgtaattcaaat
cgttgcattggtcgtttattttgggattcgttaaatgtcattgatgcaagagatgttact
gacgaagcatcgttcttatcatcaattacttatcatattacacaggctacaaatgaaggt
aaattaaagccgtatattactatatatgctccaaaggatggacctaaaattttcaacaat
caattaattcgctatgctggctatgacaattgtggtgatcctgctgaaaaagaagttaca
cgcttagcaaatcacttaggttggaaaggaaaaggtactaattttgacgtgttaccactg
atttaccaattacctaatgagtcagttaaattttacgaatatcctacttcattaattaaa
gaagtacctattgaacataatcattatccaaaattaagaaaattgaacttaaaatggtat
gcagtccctatcatttccaatatggacttaaaaatcggtggcattgtatatccaactgca
ccctttaacggttggtatatggtaactgaaattggcgtacgtaactttattgatgattac
cgttacaatttactagaaaaagttgcagatgcgtttgaatttgatacacttaaaaataat
tcatttaataaagatcgagcacttgttgaattgaactatgctgtgtatcattcctttaaa
aaagaaggcgtatcaattgtcgatcatttgaccgctgcaaagcaattcgaactattcgaa
cgtaacgaagcacaacaaggtcgtcaagttaccggaaaatggtcttggctagcaccgcca
ttatctccaacattgacgtcaaattatcatcacggatatgacaatacagtaaaagatcca
aactttttctataaaaagaaagaatcaaatgctaaccagtgccctttccatcattaa