DNA and flanking Sequence for fig|451515.3.peg.135 from Staphylococcus aureus subsp. aureus USA300_FPR3757

length of flanking sequence bp
>fig|451515.3.peg.135 Disulfide bond regulator
atagctggataaataatgatagcaccacctacgcctactagaccagatatgaacccaccg
aataccccaatgagtaacatgataactatattaacaatatccattacttacttttcacca
ataagtttacagcttcattaattaactcttgggagctttcttcatcatccgcagctgctt
ttacacattctattaaattctcactaataatgatacccatcaagcgttggagtgaactct
ttgatgcacttatttgtgtaatgacatctttacagtcttttccttcctccatcattttaa
taattccatttagttgcccttgtattctattaatacgattaatcatttttttatcataat
tcatagtcatacctccacttttaattgaataaaaatatattaatagataaacacaaatgt
gtcaaatacccctagaggtatttgacaagttccatccaactgtttaaaatacccctacag
gtatttttagggaggttattatgaaacaatacggagaaaagtttatcgatgaatttagta
aagcagaattggaaaaactagccaagcaagggcaattaattgacgttagaacagaagagg
agtatgcattaggacatatcaatggttccatacttcatcctgttgatgagattgagtcat
tcaataaagaaaaaaataaaacctattatgtaatctgtagaagtggtaacagaagtgcta
atgctagtaaatatttagctaaacaaggttataacgttataaatcttgatggtggttata
aagcttatgaagaagaaaacgatagttatgatacacaagaagaatataaaagtatagaaa
ttaaagcagatcgtaaacaatttaactatcgtggtcttcaatgtccagggccaattgtaa
aaattagtcaagaaatgaagaatattgaagtaggtgaccaaattgaagtcaaagtcacag
accctggattccctagtgacattaaaagttgggtgaaacaaacaaggcatactttagtta
agcttgatgaaaataacaatggaattaatgcgattattcaaaaagaaaaagcaaaagatt
tagatataaattattctgctaaaggtactacaattgtattatttagtggagaattagaca
aagctgtagcagcgttgattattgcaaatggtgctagagctgctggaaaagatgtaacta
tcttctttactttttgggggcttaatgcattaaaaaaagtgcaaacagttaatgttaaaa
agcaaggtattgcaaaaatgtttgatttaatgttgcccaaaaagaatatacgaatgcctc
tttccaaaatgaatatgtttggtttaggaaatatgatgatgcgctacgtaatgaaaaaga
aaaatgttgattcattaccaacacttatcaatcaagctattgagcaaaatatcaaattaa
tcgcttgtacgatgagtatggatgtcatgggtattcagaaagaagaacttagagatgaag
ttgagtacggtggtgtaggcacttatattggtgctactgaaaatgcgaatcataatttat
ttatctaattaaatctattaataaaaggagttgttatcatgttttttaaacagttttacg
ataatcatttatctcaagcatcatatttagtgggttgtcaacgtacaggagaggcaataa
taatagaccctgttcgtgatttatcgaaatatatagaagttgcagattctgaaggtttaa
caattacacaagctacagaaacacatattcatgctgattttgcttcaggaattcgtgatg
tggctaaacgcttaaatgcaaatatatatgtgtctggcgaaggtgaagatgcattagggt
ataaaaatatgccatcaaaaacacaatttgttaaacatggagatatcattcaagtaggca
atgttaaattagaagttctgcatactccaggacacacgcctgaaagtattagctttttac
tcactgatttaggtggtggttcaagtgttccgatgggattatttagtggtgactttattt
ttgttggtgatataggtagacctgattt