DNA Sequence for fig|426430.8.peg.829 from Staphylococcus aureus subsp. aureus str. Newman

>fig|426430.8.peg.829 Uncharacterized protein SAV0822
atgacgttttacaatttcatcatgggttttcaaaatgataacacaccatttggtatattg
gccgaacacgttagtgaagataaagcattccctcgattagaagaaagacaccaagtaatt
agagcatatgtgatgtctaattacacagatcatcaattaattgaaactacaaatagagct
attagcttatatatggcaaattaa