DNA and flanking Sequence for fig|426430.8.peg.2641 from Staphylococcus aureus subsp. aureus str. Newman

length of flanking sequence bp
>fig|426430.8.peg.2641 FIG01107948: hypothetical protein
cagaccataaacatcgtacacccttaagaaaacgttttcaacttttatctgttatcaaat
caaatatttaagtgaaatatttcatatttgtgaaagatttttaaaatggattgtttcaaa
aactacttatgttgtcgttaatatttactaattaactttttactctatatttcaaacagt
tgtgtgacagttttttgataacttttttacatctgaaagtaagtaatatttctaaaaact
tttaatatttatacactttatctttcgagctatttattttttgtttttgtgctgtgttta
taaaaccgcacactatattcaaaaataacttattacacatatatttgcaataagataatt
aaagtaggatattatttttagttttctgataggaatgatgatagtctataggttgaatct
ttacttttttttaaagctaaatttacatcaacttaacaatggttggttatactgaagatg
aaaatatttagtataacttagtggaggcgataaaggtgcaattgagtcattccgttaaag
ttgcaatttctatctatttagcacttatctttataacgttcacttcttatttagtcatta
ttttatatacgagtatgactggacatgatgtatcacatttcgtgttagatagtcagcatt
ctcatcatggatctcttacgcaaaaacatttgagtcttcctgaaatctcatttaaatagt
ttatcctctgtgtttcaacattcatttcccatatcgattcatttatctatcatctagacc
actacatcttagatgatttttttattttctcatttcactctttcttaaaagtcgatataa
tgaattaaatcattatcatacaccgacatattttatgttgttggtgttaagttttaaagg
ggtgagatacttggcgaataatcattcagctttgcgtttaaaaggaattatacttgccat
tgtcggtgcttgtttatggggattaggtggtactgtttctgatttcttgttcaaatataa
gaatattaatgtcgattggtacgtcactgctcgacttgtagtcagtggtgttttcttact
tattatgtacaaaatgatgcaacccaaacgttcaatatttagcgtattccaagatcgacg
tatgttaggcaaattacttatcttcagtatactgggcatgttagtagtacaatatgctta
tatggcatctattaataca