DNA Sequence for fig|426430.8.peg.2549 from Staphylococcus aureus subsp. aureus str. Newman

>fig|426430.8.peg.2549 Choline ABC transport system, permease protein OpuBD
atggaaggtaatttattacagcaattattcaattattatgttacgaactttggttatcta
tgggatttatttttcaaacacttattaatgtctgtctatggtgtgctgtttgcagcttta
attggtattccattgggaatcttgcttgcaagatacacaaaactttctggatttgtaatt
acaattgcaaatataattcaaacagttccagtcattgcaatgttagctattttaatgtta
gtcatgggcttaggttcagaaacagtagttttaacagtgtttttatatgcgttacttcca
attataaaaaacacttatactggtatagctagtgttgatgcgaatattaaggatgctggc
aaaggtatgggaatgacacgcaatcaagtgctacgaatgattgaattaccgttatctgtt
tcggttattatcggtggcattcgtattgccttggttgttgcgataggtgttgttgccgtt
ggatcatttataggagcacctacgcttggtgacattgtgattcgtggtacaaatgcgacg
gatggcacaacgtttattttagcaggtgcgattccgattgctatcattgcaatcgtcatt
gatgtactattaagatttttagaaaaacgattagacccaacaacacgacatcgtaaaaat
caatctaatcatcggccgcaaagtattaatatgtaa