DNA and flanking Sequence for fig|426430.8.peg.2468 from Staphylococcus aureus subsp. aureus str. Newman

length of flanking sequence bp
>fig|426430.8.peg.2468 hypothetical protein similar to TpgX
attgatagaattggccgaaaaaattgctcaagaacataataaacataaaatttggctagg
agtttgggagcataatcctcgtgctcaagcattttataaacgtcatggatttaaagtggt
tggtgaacatcattttcaaacaggtgatgtaacggatacagatttaattatggaaaaaga
gttataatgattgtttttgcagcagataaaatgaaatcatagtaataaatattgtgtata
ccttgaaatgctaaatgcgtaatgaattgttaaagtaaaataattaaatttatagaaaac
ataaaattcacaaaaattaaataataatgaacaaaaattagggtataataaaaagaacct
tagattgtagttatggatattgtgataattcagatcatattaatgttgacgtctttggta
acaagccatgaaaagatacacatggtagatatgtatttcaagattattcaatgaatatcg
aattataggaggagatatgtatgaaaagattagttacagggttactagcattatcattat
ttttagctgcatgtggtcaagatagtgaccaacaaaaagacggtaataaagaaaaagatg
ataaagcgaaaactgaacaacaagataaaaaaacaaatgattcatctaaagataagaaag
ataataaagatgatagtaaagacgtaaacaaagataataaagataatagtgcaaacgata
accagcaacaatctaattcaaatgcaacaaacaatgaccaaaaccaaacaaataataacc
aatcaagtaataaccaagcgaataataatcaaaaatcaagttacgttgcaccatattatg
gacaaaatgccgcgccggttgcacgtcaaatttatccgtttaatggaaataaaaatcaag
ctttacagcaattgccaaatttccaaacagctttaaatgcggctaataatgaagcaaata
aatttggtagtaataataaagtgtataatgattattctattgaagaacataatggcaact
ataagtatgtgtttagttttaaagacccaaatgcaaatggaaaatattcaattgtaacgg
ttgattatactggacaagcaatggttactgatccaaactaccaacaataatgttaatata
actatgatgcaagttaaaaaataaaacggtaaactctataatatgaattagggtttaccg
ttttttgcgtattttaaagtatcaaagtttacgttttatagtacttttaaacctcattca
cagccactgagaaatttaaacactattgattagatgtcatcttagacaatataagttgtg
aaatagattctaatggttgttctttatgttgtatttgtggatatttaatcactggtattg
cctgggaaattaaattattaattaataattgtcggtctgtataccaaatttttgatagat
gacgccaaatatcttcgttaacaccttgagactcaatgtattgactgtgatttggagtgt
ataatgctactgttttgtctatagccatcgcatcaaatattatatttgagtaatcagtga
taacgacatcagacattagaattaagtcttgagcactaagatactttggtgcaacaagcg
cctcttctgg