DNA Sequence for fig|426430.8.peg.2375 from Staphylococcus aureus subsp. aureus str. Newman

>fig|426430.8.peg.2375 FIG01110136: hypothetical protein
atggaagggatatcagggaatggctttcaattaaagaagaggtttaaaaggattacaaca
gaatgttatgattttgtagaaagatatataacaacgttttataaaaacataatattgtta
atggaaaatgaaatgtaa