DNA Sequence for fig|426430.8.peg.2353 from Staphylococcus aureus subsp. aureus str. Newman

>fig|426430.8.peg.2353 Hypothetical protein SAV2264
atgatattgaaatttgatcacatcattcattatatagatcagttagatcggtttagtttt
ccaggagatgttataaaattacattcaggtgggtatcatcataaatatggaacattcaat
aaattaggttatatcaatgaaaattatattgagctactagatgtagaaaataatgaaaag
ttgaaaaagatggcaaaaacgatagaaggcggagtcgcttttgctactcaaattgttcaa
gagaagtatgagcaaggctttaaaaatatttgtttgcatacaaatgatatagaggcagtt
aaaaataaactacaaagtgagcaggttgaagtagtagggccgattcaaatggaaagagat
acacataaagatggtaaggtaaagtggcaattgctttatataatgaatcaggatgatgat
gaaattaagccaccattttttattcaatgggaagaaagtgattccatgcgtactaaaaaa
ttgcaaaaatattttcaaaaacaattttcaattgaaactgttattgtgaaaagtaaaaac
cgatcacaaacagtatcgaattggttgaaatggtttgatatggacattgtagaagagaat
gaccattacacagatttgattttaaaaaatgatgatatttattttagaattgaagatggt
aaagtttcaaaatatcattcggttatcataaaagacgcacaagcaacttcaccatattca
atttttatcagaggtgctatttatcgctttgaaccattagtataa