DNA and flanking Sequence for fig|426430.8.peg.1969 from Staphylococcus aureus subsp. aureus str. Newman

length of flanking sequence bp
>fig|426430.8.peg.1969 Phage repressor protein cI
atttttactgctatttcatgaatcttttttaagtcttgcatttgttttcctcctattaag
atgtttgtttttcttcgactaaaacgtatttaaaatacgattcatcttttaaaaaaataa
tctcatcaatagagatatctaatgtcttagcaattctaaaagcatctctaggtttaatca
tttctgggttgttttcccaaatgttataagtagacggtgaaatgccaagtttttctgcga
aagatgactgggtgtaaccttttcgttttcgccattcatctaatttcaaggctatgtttg
atgtagttcatttttttacctccttgttaagttctgatcaaagtatatcgtaattagaat
acgattgcaagtatttttcgtaattatttttaaaaattacgtatttttattttgttaaat
cgtattttaagggttgcaattacgatttttcatagtataataaaagtgtaaaaacattat
atataaggaagggaaacaaaatggctttcaaaaattccataaaagaaatcagattgaaca
atagattgtctaaagttgagatggctaaaaaattagatgtttccgaaggtactataagaa
tgtgggaaagtggaagaactgaacctagaatgggtatggtcgaaaaaatttcaagtttgt
tcaatgtttctaaaggttatctcttaggagaaattgaagaaattgttttaccagaatttg
atagcgaaatcgaggttccatatttcggtaaagtttctgctggaaatttcgaggaagttg
caattgataatgaaaaattaaaagttccaccatttgcttttaacggtcgtaaacctagcg
aatgtatagcactaaaaataaacggagatagcatgaataaaatactcgctaacggttctt
atataattgtccatgattatagaaagtcttgtgatcataaacttaacagcaatgacatcc
ttgtattacgtctaggtggtgaatatacagttaagcgtgtgagacgtactgaaacaaaac
tacatttagacccagcaagctattcagatgaatttaaaactaattcttacgatttagatt
ctattgatgaaatcgaagtgataggcaaagttatttataactatcgtatttttgattaat
agcgcctatgtggcgtgaggaggatgagggatggaagagaataaaactttaaaagaatac
ttgcgtaaatttttagaaggctacaaatatgtagttgaaaacagatacaattatcagttt
agtagcaatccagaagctttcccattcatgagaaaagacgattacaagatttcgatattt
tatctaaatcaatctttttttgaagaaccttgcatcgtcgttatctcaaatgacagtaaa
ttaaaagaaatatataattttcgtaatattgatatcaaatatttgtctaaacactttact
tcatacatatatgattctaaaaagtatgtagaagaacaatccggattattagattttaat
aattacatttattacacatctatttactacggaaaatatatcgggaccgtaatattacaa
aacaatttagatttattttttaattatggcaaaagattagctaacgatcattacaataca
ttgatatcgaagtcgaaag