DNA Sequence for fig|426430.8.peg.1405 from Staphylococcus aureus subsp. aureus str. Newman

>fig|426430.8.peg.1405 ABC-type dipeptide/oligopeptide/nickel transport system, ATP-binding protein
atgattgagttaaaacatgtgacttttggttataataaaaagcagatggtgctacaagat
atcaatattactatacctgatggagaaaatgttggtattttaggcgaaagtggctgtggt
aaaagtacgctcgcttcattggttcttggcttgtttaaacctgttaaaggagagatttac
ttaagtgacaatgctgtgttaccgattttccaacaccctttaactagctttaaccctgat
tggacgattgagacctcattaaaagaagcgttatattattacagaggtctaactgataat
actgctcaggatcaattattattacaacatttatctacttttgagttaaacgcgcaatta
ttgactaaattaccaagcgaagtgagtggcggacaattacaaagatttaatgtcatgcgt
tcgttattagcacagcctcgcgttttaatatgtgatgagataacttcaaatttagatgtt
atagctgaacaaaatgtaatcaatatattaaaagcgcaaacgattacgaacttaaatcat
tttatcgttatttctcatgatttatccgtgttacaacgcttagttaatagaattatcgtt
cttaaggatggcatgatagtcgatgattttgcaatagaggaattatttaatgttgataga
cacccttatacaaaagaattagtgcaagcattttcatattag