DNA and flanking Sequence for fig|426430.8.peg.1069 from Staphylococcus aureus subsp. aureus str. Newman

length of flanking sequence bp
>fig|426430.8.peg.1069 16S rRNA (guanine(966)-N(2))-methyltransferase (EC 2.1.1.171) ## SSU rRNA m(2)G966
aaaacttacgaaaaagagaaacacgaaatatataattaatattattgaagttctggtatc
catttttggagccttaacacactaattaaataattataatataacgataaatcatgaaat
gcttgagggggctgtacatcgatacctaaaattggtatgtcgaatttttcagcacaatca
tttatcatttgaaactttttatttgaatctggatatggatatttaatagcgtttatcatg
atataaaatgcttggaaatgattgccagttgtagggttcataatgattgctacagatgac
tttttattttcagcttgtggtgaatgaaaatagataattttatcaatacgttgatggtta
tattcaatcatcgtcatgaattcgaacaaatctgttagaccttcaccaagtgtaataaat
gtttgtttcattggtttatcattctcctttttctcaataaattatattaaataactaaat
gaattggaagtgtgaacaacatgcgcgtcattgcaggtaaacataaaagtaaagctttag
aaagtatggaaggccgtaatacgagaccaactatggataaagttaaagaaggtatcttta
atagtttatatgatgtgtcaggtataggtttagatttatttgcaggaagcggggcgcttg
gaatagaagcactctctcgaggtatggataaggtaatctttgttgatcaaaattttaaag
ctgtaaaagttattaaatcaaatcttgcgaatttggatttagaggcacaatctgaagttt
ataaaaataatgcagatagagctttaaaagcattgtcaaaacgtgatattcaatttgatg
tcattttcttagatccaccttataataaaggtctcattgataaagctttaaaactaattt
cagagtttaatttattgaaagaaaatggtatcatcgtttgtgaatttagcaatcatgaag
aaatagattatcaaccgtttaatatgattaaacgttaccattatgggttgacagacacat
tgttattagaaaagggagaatagcatggaacatacaatagcggtcattccgggtagtttt
gaccccattacttatggtcatttagacattattgagagaagtacagatagatttgatgaa
attcatgtctgtgttcttaaaaatagtaaaaaagaaggtacgtttagtttagaagagcgt
atggatttaattgaacaatctgttaaacatttacctaatgtcaaggttcatcaatttagt
ggtttactagtcgattattgtgaacaagtaggagctaaaacaatcatacgtggtttaaga
gcagtcagtgattttgaatatgaattacgcttaacttcaatgaataaaaagttgaacaat
gaaattgaaacgttatatatgatgtctagtactaattattcatttataagttcaagtatt
gttaaagaagttgcagcttatcgagcagatatttctgaattcgttccaccttatgttgaa
aaggcattgaagaagaaatttaagtaataaaaataacagtatt