DNA and flanking Sequence for fig|282458.4.peg.2457 from Staphylococcus aureus subsp. aureus MRSA252

length of flanking sequence bp
>fig|282458.4.peg.2457 putative esterase
ttaaaatttttaatgccatcaaaatttacagattctttggtgaagacaatattaaaaatg
ggttgtttccacatgctgtatccagcgattgcggttaatataacaacaatgatttgaata
atcatgcttaccaatgaacgttttttcttaccatatcgcttaccacgatgaatattcggt
tgttgaaatgtctcatcaaatggttctaatcgttgatttggatttgtcatacaaggcacc
tccgtataaagttcttttctttacttatcaatatgtctagttgtctgttataatgatgaa
aaatcactgttcaattgtagtcttaaatttgaaagtgaaaaagaaaatatcttctacatt
atatactttttttggcaaagaatgtaggggatagacaatcattggatacataaaatatat
aaaggtaggttaagacattgattagaaaccgtgttatgaatagcgttgtcaataaatatt
tgcttcacaatcgctcgattatgtttaaaaatgatcaagatgttgaaagatttttttata
aaagagaaattgaaaatagaaaaaaacataagcagccttcaacattaaatgttaaagcaa
atttagaaaaattatcattggatgatatgcaagtctttcgctttaatttcagacatcaaa
ttgataagaaaattttatatattcacggtggattcaatgcactacaaccatcaccgttcc
attggagattgttggataaaatcactttaagtacattatatgaggttgtactgcctatct
atccaaagacaccagagtttcatattgacgacactttccaagcgatacaacgtgtttatg
atcaattagtatctgaagtaggccatcaaaatgtcgtagtcatgggtgatggttcaggtg
gtgcactggcattatcctttgtacaatctcttttagacaatcaacagccattaccgaata
aattgtatttaatctcaccaattttagatgcaacactatctaataaagatatttcggatg
ctttaatcgaacaagatgcggttctaagtcagtttggtgtcaatgagattatgaaaaaat
gggcgaatggcctaccattaacagataagcgcatatcaccaattaatggcacaatagaag
gattaccaccagtttatatgtttggtggtggacgtgaaatgacacatcctgatatgaagc
tgttcgaacaaatgatgttgcaacatcatcaatacattgagttttatgattatcctaaga
tggtacatgattttccaatttatccaattagacaatcacataaagctattaaacaaattg
ccaaatcgatagatgaggatgtaacacaaaacaactaataacatataaatgacccagtta
cgatttcatggtagaagatatttaacatgaaaacgcaactgggttttgtttttgaaaata
tagcaaggattatatagactaattgttaatgagcttctgagtgaaaatcaccaataagtg
tattgatatgtgtgatgataaagtattgccctttaatttgataaaattgatctaaaaaat
tatcgaattgacgtggaatatcactaagttctgcaaagttagctgttttatcataattgc
gatgagcaacctcattttgaaatttatcataatgttctaggaaatgttgatcttcaagct
gttgttccacaatagtcataatattatcgatagcttgcttttgtccttgaacataagcca
tatgcacgccacgcttaagtaactgatttgctggtccgttaatgtataaccctttttgtg
catttaattctgttaattcaaacttaacatcatctaataaatctagtagttcgatatg