DNA and flanking Sequence for fig|273063.1.peg.324 from Sulfolobus tokodaii str. 7

length of flanking sequence bp
>fig|273063.1.peg.324 Threonine dehydratase, catabolic (EC 4.3.1.19) @ L-serine dehydratase, (PLP)-dependent (EC 4.3.1.17)
gaagcttcaaaaaataagtcctcctcgtgtttattttgtgatgtaatcgaaaaaaaggaa
gataaaaataactggatcgtttataggggtaaattctcatttattatactgaatgcgttt
ccttataaccctggacatttaatgattgttccttataaacatgtcagttcaatagaagga
ttagaagaaaaagaaatactagaaatgatgtattttctcaaagtaagtatgaaagcaatt
aggaaagtctattcaccagatggctttaatataggaataaatattggcagagttgctgga
gcgggaattgatcaacatgttcatatccatttagtgcctaggtggaacggcgatgctaat
ttcatgccagttataggcggtgttaaagttcttccagagattttagaagatacctataat
aaattaaagccagaaatagaaaagataattaatgaggaagccctcgatctctgaaaagtg
atgactgcagggttttcctgatgtcttatacaaaatattttgatgaaatagtaaaaattc
aagatagaattaaacaatatattcatgagacgcctattgattactcaaaaaccttttctg
atatgattggagctcaaatatatttaaagcttgaaaatttgcagaaaacaggttctttta
aggtaagaggagctttttcaaaattgacaagcctagccgaagaagaaaggaaaaaaggtg
ttatagcggtttccgcgggtaatcatgctcaaggtgttgcatatgctgcaaaagttttag
gaattaaagcaactatagtaatgccagaaactgctccaatctcaaaatatcaagctacaa
agtcatacggtgctcaagttattttgtatgggaaatttcttcatgagagtatgaaaaaag
ctgaggagattataagagaagaaggaagtattcttgttcatccttacggagatcttgatg
taattttgggtcaaggtacattaggactagaacttttgccatataatccagatattgttg
ttgttcctataggagggggaggactaatatcaggaatatctatagcattaaaagcaaaaa
atccaaaaaccaaaataataggtgtacaatcttcagcttctccttcattaaaggtctcaa
aagatcttcataggctagtagagattgagccctctttttcgatagcagatggaattctag
taaaatctccctctgaaataacgtttagcataatagatgaattagtggatgatattgttc
ttgttgatgatgaagaaatagcaaatgctatagtatatttattagaaagaaataaaacat
tagtagaaggagcagctgctgcttcattagcagcacttttatctggaaagattaaagttg
cttataatcataaagctattccggttctaagtgggggcaatatagatctttcaatgttat
ccagaattatagataagatgcttttcaagaataaacgaatagtcaaagtgaaggtaatag
taccagataaacctggatatcttaataaagtattaagtagagtagcacaaataagaggga
acgttatcgatgtagttcatgatagaacaagcagtgatgttaaacctggttatactaaaa
tttatgtaatgtttgaagtacctagtggtgatgctctttcagatttcatgtacaacttag
ctttagatggtattgaggctaaattagtagaatagtttatatataggaaaaaagttaaat
tattgatccaaatggaatttactatttaggtcccaaaggaagtttcactaatgaggttgc
tgaaatttttgaaggagataaaataccaaaaagaactattacagaagtatttaatagcat
aacagataattctatagggatagtacctatagaaaatagcatagaaggacctgttcatga
aacattagataatttatttaaaaatgaagagatttatgtgaattatgagatagaaaaaga
gataaaattagttcttgcagtaaatccttccgttaatagtttaaacgatatagaagttat
ctattctcattctcatgctataaatgaggcaaaagaaacacttagcaaatacaattttac
taattttgttccagtagaaagtacatctactgcagctttatatgcatctaaacaaaaata
ttctgctgcaatatgttcagagtatgcagctaatttatataatttaaaaattatt