DNA and flanking Sequence for fig|158879.11.peg.753 from Staphylococcus aureus subsp. aureus N315

length of flanking sequence bp
>fig|158879.11.peg.753 Excinuclease ABC subunit A
tgatgttatcgtaggtattaatttattaagagagggtattgatataccagaagtttctct
agttgtcatattagatgcagataaagaaggatttttacgttctaaccgctcattaattca
aacaataggtagagctgcgcgtaacgataaaggtgaagtcattatgtatgccgataaaat
gactgattcgatgaagtatgcaattgatgagacacaacgtcgtcgagaaatacagatgaa
acataatgaaaaacatggtattacacctaaaacaattaataaaaaaatacatgatttaat
tagtgctactgttgaaaatgacgaaaataatgacaaagcacaaactgtgatacctaagaa
gatgacgaaaaaagaacgtcaaaagacaatcgacaatatagaaaaagaaatgaaacaagc
agcgaaagatttagatttcgagaaagctacagaattaagagatatgttatttgaattaaa
agcagaagggtgacaagtaaatgaaagaaccatccatagtagtaaaaggtgctcgtgcgc
ataacttgaaagatattgatatcgaactacctaaaaataaattaattgttatgacaggtt
tatctgggtcaggtaaatcgtcattagcattcgatactatatatgctgaaggacaacgac
gttatgttgaatcattaagtgcctatgcgcgtcaatttttaggccaaatggacaaaccag
atgttgatacaattgaaggattatcgccagcaatttcaatagatcaaaaaacaacaagta
aaaatccaagatcaactgtagcaacagtaacagaaatatatgattatatacgtttgttat
atgcacgtgttggtaaaccttactgtccaaatcacaatatagaaattgaatcgcaaacag
tacaacaaatggttgaccgcattatggaattagaggcacgtacaaagattcaattattag
cacctgtcatcgctcatcgtaaaggtagtcatgaaaagctaatcgaagatattggtaaaa
aaggttatgtacgtttaagaatcgatggcgaaattgttgatgtaaatgatgtacctactt
tagataagaacaagaatcatacaatagaagttgttgtagaccgattagttgttaaagatg
gaattgaaacacgactagctgactctatagaaactgcgttagagctttcagaaggacaat
taacagttgatgtcattgacggggaagaccttaagttttcagaaagccatgcttgtccta
tatgtggattttcaatcggagagttagaaccaagaatgtttagctttaacagtccttttg
gtgcttgtccgacatgtgatggcttaggccaaaagttaacagtcgatgtagacttggttg
ttcccgacaaagataagacgctaaacgaaggtgcaatagaaccttggataccgacgagtt
ctgatttttatccaacattgttaaaacgtgtttgtgaagtttataaaatcaatatggata
aaccttttaaaaagttaacagaacgtcaacgtgatattttattgtatggttctggtgaca
aagaaattgaatttacatttacacaacgtcaaggtggtactagaaaacgaacaatggttt
tcgagggtgtagttcctaatataagtagacgattccatgaatctccttcagaatatacac
gtgaaatgatgagtaaatatatgaccgaactaccttgtgaaacttgtcatggaaagcgat
tgagtcgtgaagcgttatctgtttatgtaggtggtttaaatattggtgaagtagtcgaat
attcaatcagtcaagcgctgaactattataaaaacattgatttgtcagaacaagatcaag
cgattgcaaatcaaatattgaaagaaattatttcccgactcacttttttaaataatgtgg
gacttgaatatttaacgctaaacagagcttcaggtacactttcaggtggtgaagcacaac
gtattcgattggcaacgcaaattgggtcgcgtttgactggtgtcttatatgtattagatg
agccatcaattggactgcatcaaagagataatgatcgattaattaatacacttaaagaaa
tgagagatttaggaaatactttaattgtagttgaacacgatgatgatacaatgcgtgcgg
ctgattacttagtggatatagggcctggtgctggtgaacatggaggacaaattgtgtcta
gtgggacacctcaaaaggtaatgaaagataaaaaatcattaacaggacaatacttgagtg
gtaagaaacgtattgacgtacctgaatatcgcagaccggcttcagatcgtaaaatttcta
tacgtggagctagaagcaacaatcttaaagggattgatgtggacataccactatcaatca
tgacggttgttacaggtgtatcaggttctggtaaaagctcattagtaaatgaagtattat
acaaatcattagctcaaaaaattaataaatctaaagtaaagccaggattgtacgataaga
ttgaaggtattgatcaacttgataaaattattgatattgatcaatcaccgataggtagaa
cgccacgctctaatccagcaacatatactggtgtgtttgatgatatacgtgatgtgtttg
cgcaaacaaatgaagctaaaattcgaggatatcaaaaagggcgttttagttttaatgtaa
aaggtggacgctgtgaagcttgtaaaggtgacggtattattaaaattgaaatgcattttt
tacctgatgtttatgttccttgtgaagtgtgtgatggtaaacgatataatcgtgagacac
tagaggttacttacaaaggtaaaaatattgctgacattttagaaatgactgttgaagaag
caacacaattttttgaaaatattcctaagattaagcgcaagttacaaacactagttgatg
ttggtcttggatacgtcacattaggtcaacaagctacaacgttatcaggtggtgaggctc
aacgtgtgaaacttgcatctgaacttcataaacgttcaactggtaaatctatttatatcc
tagacgaactaacaacagggttacatgttgacgatattagcagattattaaaagtattaa
atcgattagttgaaaatggtgacactgttgtaattattgaacataacctagatgttatca
aaacagcagactatattatcgacttaggtcctgaaggtggtagtggcggtggtactattg
ttgcgactggcacacccgaagatattgctcagacaaagtcatcatatacaggaaagtatt
taaaagaagtacttgaacgagataaacaaaatactgaagataaataagattaaaagaagt
gaagggtgttgtaaatttacccttcacttctttttattaatttagtaatgaatagtagaa
agaaaagatgcgtaaaaagaattatgttaagatagggtcaatctagagttgctaaacata
aatcgaaactgagagtgggacagaaatgataaagaatcactaatgatttattatgtagtg
gttctttgtcattagccacagctattgtgtacttaaaaataggaatgcatgagtgcaact
catgcataagaaatactaatttctaaagaaaaagtatttctttatgttggggcccacccc
aacttgcattgtttgtagaatttcttttcgaaattctctgtgttggggccccgccaactt
gcattgcctgtagaatttcttttcgaaattctttatgttggggccccgccaactaattac
aatatatcattgtagagcttaggtcattgatttatggctcggacttttatggcgatatga
accatgt