DNA and flanking Sequence for fig|158879.11.peg.298 from Staphylococcus aureus subsp. aureus N315

length of flanking sequence bp
>fig|158879.11.peg.298 FIG01107881: hypothetical protein
catttctgtgcaagtatttgatgatttatggatggatttatatgatttgtttgaggagtt
aagagatttatttaaagaagaagatttagaaccatggacatcatgtgaatttgactttac
aagagagggtaaattgaaagtatcatttgattatatagattggataaatacagagtttga
tcaattgggccgtgaaaattattatatgtacaaaaaatttggggttataccagaaatgga
atatgaaatggaggaggttaaacaaatcgagcaatatattaaagagcaagaagaatagac
aatcttaatgtgagactaaacaataaagctttgtttagtcttttttggcggttaagtaaa
aagcaatagataccgtaaagttgatgctcgtcaaataataatataaagatagttttatgc
tttgtatagataaaaacctaagtacttataactttaaatacgtaatatgctatttaaaag
ataatgtataggagacagatatgactactaaagaaaatattgatactcttcgaaagccag
gtgcacaagccttaagtttaatatcattgtttttgatacttttttcatgtctaactttct
tttttggtttagattatgaaaggtttccaaactatttaaagataacgacaattatagaat
taataattattgtaattagtttacttcaatggattaggtttatagatttcgaaaaagaaa
gtgcacggaaatataaaaaaatatatgctcgatttttagttattataaatgtgttaacta
ctatcactgtagtatttgcactgtgtaacctttattattttgcagctgtacaaaaccatt
atgatttattcaattattggttaatgggtacgatttcaatcataattagctatttattat
tagtaattggcggaatgtttacgttgttaaaattacctaaagtaacaaaacgctggggtg
gtaaaactaaaacacatttcggtttattattaactgcgttgagctcatttatatatattg
aaaaaattatcgaatatatattgattcctaatgtcgtagaatccaagtttataattattg
tgagcatgttggttatcgctggagcacaatttgtggcatttcaatttattatgcaataca
gtagattctatatttttgaattaaacacagaagatgatgactaaatgattttgtaaatac
tgtgaagtatacttaaattaagaaaatcaacttcaacgtatatcaccatattattttata
ctcaatgatgtgaatggatttaagtggattgatattaaagtaaaagttatggaatattga
ggtgcgaatatggagttcttattattaattgtcgtagccggactgtattatattatatat
ttaactgctgtgatgtattctgaaaaaatagtagtattgcctataatcatctatgccatt
ttgtttgtaataattggtatcacttatatctttataggcgacagctatgatcaattaaca
aatttcaatgtgattttgtatatggggagtttgttttatgcatggatggctattagaaat
ctttggaacagaccactattactaaaatataagaacattacagatagttcaagtggaata
gttaataaatctgaatacaattcagttgaaagcttacgtataaatattgaaatagctaag
tata