DNA and flanking Sequence for fig|158879.11.peg.2704 from Staphylococcus aureus subsp. aureus N315

length of flanking sequence bp
>fig|158879.11.peg.2704 Chromosome (plasmid) partitioning protein ParB-2
aaataatgtttccgcagttaaaagtgacgattgttgattcattaaataagcgtattcaat
ttttaaaccatttagcgtcagaattacaattacaggatgtcagctttatacacgatagag
cagaaacatttggtaagggtgtctacagggagtcttatgatgttgttactgcaagagcag
tagctagattatccgtgttgagtgaattgtgtttaccgctaattaaaaaaggtggacagt
ttgttgcattaaaatcttcaaaaggtgaagaagaattagaagaagcaaaatttgcaatta
gtgtgttaggtggtaacgttacagaaacacatacctttaaattgccagaagatgctggag
agcgccagatgttcattattgataaaaaaagacagacgccgaaaaagtacccaagaaaac
cagggacgcctaataagactcctttacttgaaaaataatgcataatcctttacaactaac
ataaaaggagcgaatggataatgaaaaaacctttttcaaaattatttggtttgaaaaaca
aagatgacatcattggacatattgaagaagatcgcaatagtaatgttgaatccattcaaa
ttgaacgtatcgttcccaaccgttatcaaccaagacaggtgtttgaaccaaataaaatta
aagaacttgctgaatcaatacatgaacatggtttactacaacctattgttgtaagaccga
ttgaagaagatatgtttgaaattattgctggagagcgccgatttagagcaatacaatcac
taaatttacctcaagcagacgttattattcgtgatatggatgatgaagagacggctgttg
ttgcattaattgagaatattcaaagagaaaatttgtctgttgttgaagaagcggaagcct
ataagaaattattggaaattggtgatacaacgcaaagtgaattggcaaaaagtttaggta
aaagtcaaagctttattgcaaataagttgcgtttattgaagttggcgccgaaagtactac
ttcgcttaagagaaggtaaaattactgaacgccatgcgagagcggtattatcattgtctg
atagtgaacaagaagcgttgattgagcaagtcattgcacaaaaactaaatgtgaaacaga
ctgaagatagagtacgccaaaaaacggggcccgaaaaagtcaaagcacaaaaccttcgct
ttgcacaagatgtcactcaagcacgagatgaggtaggcaaaagtatccaagcgattcaac
aaacaggactacatgttgagcataaagacaaagatcatgaagattattatgaaataaaaa
ttcgaatatataaacgttagtagtaggatgtcgtatacatgatgactaacacataaaaga
caaagctaagatcataacagctttgtctttttttgttttacgtgaaacataaaaatttat
atttatatgttgatcaggctggtacataaatcaatgttctatgctctacgaagttatatt
ggcagtagttgactgaacgaaaatgcgcttgtaacaagcttttttcaattctagtcaacc
ttgctggggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccta
atttgagctggatataccttcatttgaaccctttattgctagtttatgaaagtatcatga
aagctttatgaacatcgcttgagttgcctttacagtagaaaatttaagttttacactttg
tgtgaatgatacgttttgtattgaattaattatagaaaggtacgttgaagatgttttcaa
ttggaagtgcaattcttcattttgtcattggtggtatcgc