DNA and flanking Sequence for fig|158879.11.peg.2688 from Staphylococcus aureus subsp. aureus N315

length of flanking sequence bp
>fig|158879.11.peg.2688 Transcriptional regulator, PadR family
ctaaatcatcttcagttagatttcgtgcacgttcaggtaatgtttggagaccttctaaaa
tcttttcaatactcggtacttcatccttccattcatctggagacgaaccatttccgaata
aaggtctatagatatttaaatcaatattctctttaccagcaacagctaaggccgattcaa
aaattgttaatacatgcccaaattgccaatgaatggtattagaaaaaggctcatgataat
catcaagtaccttttcaactttccaagcatcatacacatttactaaatatcctaacccca
tatcaatgacatcaaatactgtttttgtagtcattattaattcctcccccataaataaaa
catacttccgtaagtattaccctattaacaaagttgttagtcatttaaggaatgtgtaca
acaactaccttacaataaaagatagttgacgaaaagttctcaatgtactatcttattatg
taagatagtaggtgattaaaatgtcagtgtcagatcagattatgaaaggtctcttagatg
gggcgatattaggtctcattgcccaaggcgaaacgtatggatatgaaattatgacgaaac
ttaagaatcaagagtttccagagataagtgagggtagtatttatccagttttaatgcgtt
taaacaaaaaaggatacgttgatacgacaataaaaaaatctagtaatggcggcccgaggc
ggaaatactatacgattaccgattcaggtttaaaggaactaaaagtatttaaatcaaaat
ggcaagctttgaataaagggatgattaacttgtttggaggggaaaacgatgttaactaaa
caatctcaagattttttagaaaaattacgtgttgaattgttatttagaggtaagactgaa
gcagaagtagaagagttattggaagagctcgaagatcatttaactatggctgaaaaaaat
aacgaagatacaagttcaattattaatacaccgattaagtcaatggctgatcaattatca
cctgagataagtcttactaccggtttgtataaatatattactttgtacttctcttttata
ttagcagtcattataattcctaggtttttagatttgggtacatttgatgtgacaattgca
tttttactttatatagctagtatcgttattttaggtgttgtcattggtatgctgattcta
cgcaatacattagtccgatttggtgaccaaaaaataacgtatgttataaatgtgacttat
ggaattgtcgtatttttatggatgatttttggtggtttgattattaaaaaatatcctatc
tatagtttctttgagttaa