DNA and flanking Sequence for fig|158879.11.peg.2361 from Staphylococcus aureus subsp. aureus N315

length of flanking sequence bp
>fig|158879.11.peg.2361 Nitrate/nitrite transporter NarT
atgttgtacctcaaatttctttttaaaaggtactaatatttctttagtgaaaattgaatc
acggtcgtttattggtgccttgagtatattcttatagacggaatctgatctaataatatt
gattttatacatgataaacctccttatgttgtcagcataaaggataacgtaacgtgattt
tcaagcagtaattgtaactaattgaaaaaaataagaaaagtatgtgagtgttcctaaata
atatgattaaaatgatggcgaataagtgtctaaaagcatcttaaagggacattgtatagg
gtaaatcacttcataaataagggaaaatccttatgttcactttttcacaatcataataaa
atatatatgtagtcaatactttgtctatattgaatgttttcatataaatgaaagcatttt
taaataacattgacctctaatatataggcagagtattgatatctattaaaaaataaatga
ttttgatgaaggtgaaacgtatgtacaaaacaaaaggtggctttcaacttacattacaaa
cattaagtttagtggttgggtttatggcttggagtataattgcgccattaatgcccttta
ttaaacaagatgtcaatgttactgaaggtcaaatatcaatcattttagcgataccagtta
ttttgggatcagtgctccgtgtgccatttggttatttaacaaatattgttggtgctaaat
gggtattctttacaagttttatcgtattgttattcccgatatttttcttaagccaagcac
aaacgccgggtatgttaatggcatcaggatttttccttggcgtaggtggcgcaattttct
ctgttggtgttacatcagttcctaaatatttcccaaaagaaaaagtaggtctagcaaatg
gtatttatggtatggggaatatcggtacagcagtttcttcatttttagcaccaccgatag
cgggtattattggttggcaaacaacagttagaagttacttaattattatcgctttatttg
cattaattatgttcatttttggtgacacacaagaacgtaaaattaaagtgccattaatgg
cccaaatgaaaacattatctaaaaactacaaattatattacttaagttattggtatttca
ttacttttggtgcttttgtagcatttggtattttcttacctaactacttagtaaatcatt
ttggaattgacaaagtagatgctggtattcgttcaggtgtattcattgcgctggcaacat
tcttgagaccaataggtggtatactaggtgataaatttaatgcagttaaagtactgatga
ttgattttgttattatgattatcggtgccgttattttaggtatttcagaccatatcgcat
tattcactgtaggctgtttaacaataagtatttgtgcaggtattggtaacggcttaattt
ttaaattagtaccatcctacttctcaaatgaagcaggatcagcaaatggtatcgtatcaa
tgatgggtggtttaggaggattcttcccaccgttggtcatcacatacgtagctaatttaa
caggttcaagccatttagcatttattttcttagcggtatttggatgcattgcattattta
ccatgcgccatttatatcaaaaagaatatggttcattgaaacacagttgatatgtaatac
atgacattcatttagttaaatacaaagccttaatatcatgcacaatattcgtagcatgac
attaaggctttagtagtgtattcattttaaatttaactatgaaattggaatagatgttga
tgaagtagtttcattgcttggtttgattttaggcaatgtaatggttaataacccattttc
aaaactagcagtaatatgttgcttatcaacagcttcaaaatcaaattgacgcattaatga
ttcgaagttacgctcatctaaaatgagttgttcagatttgtattttgcgcttctagtagc
ttgaatagtgagcgtattattattgaaatcgatactaatatcttctttatttacacctgc
tagttcagcttctaagtaatataattcgtctgtttcatatatattcgttacaaatgaagg
tgttgaaaagtaattaaatacttgtttacctaaatctttaaatgtatcacttggattacc
gttaaaaaag