DNA and flanking Sequence for fig|158879.11.peg.1976 from Staphylococcus aureus subsp. aureus N315

length of flanking sequence bp
>fig|158879.11.peg.1976 Hypothetical SAV0794 homolog in superantigen-encoding pathogenicity islands SaPI
tactttgtgtactaattatcacgaggctatatatatcaatgttttaaccagtacacgaaa
gtaaaaaaaggtgtgtatttaactgtgtatggtacacaatcaatataaatatggaggtta
cacatggataaagaacaacttaaaaagtatatatacgaatatgtgaaagaatataaggag
ataccgatatatcagttagaagatttgtttaaagaaataaatcacgactatatagggaga
actagtatcacacacgataaggatgagaatattgtgttttggagtggatggaacaaaatt
acaatgtttgcgttgattgaattagttaaaagtgaacaacttgatttagtgtatagaggt
agttttataatgcgttatttgttggatggtagagttcctaatttaccattagctatttgt
tatccagaagatggacaacaaactgacgtgccctcatgggtgcctatggtattaagaata
aataaagaggagaaaatcaaatgaacttagaaactatcgtaaaccaatttgaaacacgag
caggcacgttactaaggtactacacaggattattagaacatagtaaagtgcaaccgtgtt
gctttaagttatacaatgatccatttgatatggtatacgtgatgatgaacagcaagctat
tcggtcatgtatatattaaagattgtaaagtaaggcaatcatttgaattagcgtcaccta
agcacactgaggggcttataagaagcatagaggggcattatgtaggttatgaattacatg
acggtaaacatctttctattagtgatatgatggctagtcatttgtttgaagatgagtatt
ttatgtatggattacaaacatatgcagaatcaaataatagtgatgtgtttgagtacctag
aaaatggatttgatacagatacacttgagggcattcaatcaagtaatactgatgtgatag
cgaatattgaaatgttgtatcagttagctacgggaatcaatgaaccagcaccagagttag
ttgagggattaaaattagtaactgagtttgtacaagatgagaatgcgacacaagaggatt
acaaggctttagaacgtaaattgaatgatctaaaagcgtcttactatagcttgagtaaat
aatgttatgaggggtcacatgtagtgtgtggctcctaataaaatactatgattttatacg
aggtatagcagtttaaaatggtaaggttttcggaaggtgttggcttttaaaatcggaagg
tatacagtctttgagaattgaaaaaatggcaagatttgtgcaaggtgtgcgaactttgtt
aacgctaatacaagctaaagtttgtgtttttggcataggcctaaaagttaagtttgttcg
ctgtttgttcgtgttattttaccgaacttaagttctatattaggttaatgtgaaaagcct
aacgttaagtttataacatgattttataagtgttatatatgataagctaaacaattgata
aaacgcgctataaagcgaacgtaagtttgttttagacctgtaaaaatggtataatttagg
tatgaaataattaaaagaaagaggtgtagaaatgcaaagtatcgcagaaaaagagacgta
tcatttacccaccgaacacctg