DNA and flanking Sequence for fig|158879.11.peg.1022 from Staphylococcus aureus subsp. aureus N315

length of flanking sequence bp
>fig|158879.11.peg.1022 DUF1054 superfamily protein
acaaaacctgcataaggtttaccatcgatataaataccaattgaaattgcgaaattttct
tgttgatgaacaaaattcaatgtaccgtctattgggtcaacaacccataccgtacctttg
gaagtatcgatgtcatgaccatgcccttcttcacctaatacttgatgattgggatatgtt
tctaaaattgtatcaaaaatgaaatcttctgttgctttatctacatttgtaacaaggtca
ttcggatttgactttgtttcaattgttaaattttgctccatcaattgtttaattctaatt
cctgcttcttgaataagtccttgggcaaatccataaagtgccataacatcatctcctaac
atctttattatacatcaacattttataaaaataacttcttatgataaaaatgaaaatact
aattttaatgagagcgtcttaagccgcaattgataaaacatatgctacaatatttttaaa
cactatacaggaggtactctatgacaaaatatacatttaaacctaaagatttcaaagcgt
tcaacgtagaaggcttagacgcacgaatggaagctttaaacgaatacatacgaccacaac
tccatgaattaggagaatattttagtgacttctttacaagtcaaactggtgaaacatttt
atcctcacgtagcaaaacatgctagaagaagtgtgaatgctcctaaagatacatgggttg
cttttgctacaagcaaaagaggctataaaatgttacctcatttccaaattggtatgtttg
aagatcaactgtttgttatgtttggaatcatgcatgaagcaaaagataaagcaacacgtg
caaaagtttttgaaagaaaatttaaagctattcaacaattacctgatgattatcgtgttt
gcttagatcatatgaaacctgataaaccatttattaaagatttaacggatgatgatttaa
aagaagcgatacaaagagccatcaatgtgaaaaaaggtgaattctttatagcgcgtgcaa
tcacaccacaagataaaagattaaaaagtgacaaagcatttattgcatttttagaagaaa
ccttcgatcagttcttaccattttattctgcataaataactttgtttaaataatagagca
cgtaatcacatccatgatttcgtgctcttttttcttaatattaaatcgaacgttcaacat
aataattcatacttttaaaaaaattaaaataaatttaggttgacctaaacattttattag
gttattatattgtccataagaagtagaggtgagtcaaaatgaataataaacgacattcaa
caaatgaacaattaagtttagacgaaataaacaatacaattaaattcgatcatcgcagtt
caaataaacagaaatttttatcatttcttggacctgggttattagtcgctgttggttaca
tggatcccggaaactggataacatcaatgcaaggtggcgcccaatatggctatactttgc
tattcgtaattcttatttcaagtttatcagcaatgttacttcaaagcatgacagtgagat
taggaatagcaacaggtatggacttagctcaaatgacacgacattatttatcaag