DNA and flanking Sequence for fig|1116007.3.peg.4695 from Escherichia coli 2731150

length of flanking sequence bp
>fig|1116007.3.peg.4695 Ketol-acid reductoisomerase (EC 1.1.1.86)
gtgttccgcgcggaagcgatccagaatcggcggcagatggctgtaggcagcggtcaccga
gcagaagatatgtaattcgccagagagcgacggcccttgctgatcgatggtgtggcgcaa
ctgctgatactgcaacagcgtttgctgggagaaaacgcgcagctcttcgcccgcttcagt
cagcgtcaccgtgcggttatcgcgcacaaacagcggctgaccgagatcttcttccaggcg
ctgaatctgccgtgagagcgtggatgggctaacgtgcatcgcccgcgcgctgcggccaaa
atggcggctttccgccagatgcaggaaggttttcagatcgcgtaaatccacagggacagc
cctcgatgttgacgttgcaaaaattgcaatgtgacgttgtgaatatatcaatttccgcaa
taaatttcctgtcatatagtgaattcaatctcgcaaacgcgaaccgaacaataagaagca
caacatcacgaggaatcaccatggctaactacttcaatacactgaatctgcgccagcagc
tggcacagctgggcaaatgtcgctttatgggccgcgatgaattcgccgatggcgcgagct
accttcagggtaaaaaagtagtcatcgtcggctgtggcgcacagggtctgaaccagggcc
tgaacatgcgtgattctggtctcgatatctcctacgctctgcgtaaagaagcgattgccg
agaagcgcgcgtcctggcgtaaagcgaccgaaaatggttttaaagtgggtacttacgaag
aactgatcccacaggcggatctggtgattaacctgacgccggacaagcagcactctgatg
tagtgcgcaccgtacagccactgatgaaagacggcgcggcgctgggctactcgcacggtt
tcaacatcgtcgaagtgggcgagcagatccgtaaagatatcaccgtagtgatggttgcgc
cgaaatgcccaggcaccgaagtgcgtgaagagtacaaacgtgggttcggcgtaccgacgc
tgattgccgttcacccggaaaacgatccgaaaggcgaaggcatggcgattgccaaagcct
gggcggctgcaaccggtggtcaccgtgcgggtgtgctggaatcgtccttcgttgcggaag
tgaaatctgacctgatgggcgagcaaaccatcctgtgcggtatgttgcaggctggctctc
tgctgtgcttcgacaagctggtggaagaaggtaccgatccagcatacgcagaaaaactga
ttcagttcggttgggaaaccatcaccgaagcactgaaacagggcggcatcaccctgatga
tggaccgtctctctaacccggcgaaactgcgtgcttatgcgctttctgaacagctgaaag
agatcatggcacccctgttccagaaacatatggacgacatcatctccggcgaattctctt
ccggtatgatggcggactgggccaacgatgataagaaactgctgacctggcgtgaagaga
ccggcaaaaccgcgtttgaaaccgcgccgcagtatgaaggcaaaatcggcgagcaggagt
acttcgataaaggcgtactgatgatcgcgatggtgaaagcgggcgttgaactggcgttcg
aaaccatggtcgattccggcatcattgaagagtctgcatattatgaatcactgcacgagc
tgccgctgattgccaacaccatcgcccgtaagcgtctgtacgaaatgaacgtggttatct
ctgataccgctgagtacggtaactatctgttctcttacgcttgtgtgccgttgctgaaac
cgtttatggcagagctgcaaccgggcgacctgggtaaagctattccggaaggcgcggtag
ataacgggcaactgcgtgatgtgaacgaagcgattcgcagccatgcgattgagcaggtag
gtaagaaactgcgcggctatatgacagatatgaaacgtattgctgttgcgggttaagtgc
gcgctgatgccctcaccccgaccctctcccacagggagagggagaaaacactcaaggcct
tctcctggagaaggccttgctattagttgcggtacagcaccttaatgatgtgatatccga
actgggtgtgcagcgggccggtcggctccagtaccggacaagagaaaaccactttatcga
acgccggaaccatctgaccctggcggaattcacctaaatcaccgccgcgtttgcctgatg
ggcaaatggagtgtttcttcgccagcttgccgaaatcggcaccgttcttaatctgctcga
gaagatccagagccagtttctcttcttttacaaggatatgcagtgctgctgctgtttttg
ccatgatcgtgccttgagtgaataattgtcaggcggcgattttagcatgatccgcagatg
ctaacgtaattgtcagtcagggaggggctggtacatatatggcaaaagcccggaaaatcc
gggcttcgcaggtccc