DNA and flanking Sequence for fig|1005542.3.peg.4632 from Escherichia coli EC1847

length of flanking sequence bp
>fig|1005542.3.peg.4632 Branched-chain amino acid aminotransferase (EC 2.6.1.42)
ccacccttaccgataaccccgatttcctcaagttagccagcgccttcggcatccctggcc
aacacatcacccgtaaagaccaggttgaagcggcactcgacaccatgctgaacagtgatg
ggccatacctgcttcatgtctcaatcgacgaacttgagaacgtctggccgctggtgccgc
ctggtgccagtaattcagaaatgttggagaaattatcatgatgcaacatcaggtcaatgt
atcggctcgcttcaatccggaaaccttagaacgtgttttacgcgtggtgcgtcatcgtgg
tttccacgtctgctcaatgaatatggccgccgccagcgatgcacaaaatataaatatcga
attgaccgttgccagcccacggtcggtcgacttactgtttagtcagttaaataaactggt
ggacgtcgcacacgttgccatctgccagagcacaaccacatcacaacaaatccgcgcctg
agcgcaaaaggaatataaaaatgaccacgaagaaagctgattacatttggttcaatgggg
agatggttcgctgggaagacgcgaaggtgcatgtgatgtcgcacgcgctgcactatggca
cctcggtttttgaaggcatccgttgctacgactcgcacaaaggaccggttgtattccgcc
atcgtgagcatatgcagcgtctgcatgactccgccaaaatctatcgcttcccggtttcgc
agagcattgatgagctgatggaagcttgccgtgacgtgatccgcaaaaacaatctcacca
gcgcctatatccgtccgctgatcttcgttggtgatgttggcatgggcgtaaacccgccag
cgggatactcaaccgatgtgattatcgccgctttcccgtggggagcgtatctgggcgcag
aagcgctggagcaggggatcgatgcgatggtttcctcctggaaccgcgcagcaccaaaca
ccatcccaactgcggcaaaagccggtggtaactatctctcttccctgctggtgggtagcg
aagcgcgccgccacggttatcaggaaggtatcgcgctggatgtgaacggttatatctctg
aaggcgcaggcgaaaacctgtttgaagtgaaagatggtgtgctgttcaccccaccgttca
cctcctccgcgctgccgggtattacccgtgatgccatcatcaaactggcgaaagagctgg
gaattgaagtgcgtgagcaggtgctgtcgcgcgaatccttgtacctggcggatgaagtct
ttatgtccggtacggcggcagaaatcacgccagtgcgcagtgtagacggtattcaggttg
gcgaaggccgttgtggcccggtcaccaaacgcattcagcaagccttcttcggcctcttta
ccggcgaaaccgaagataaatggggctggttagatcaagttaatcaataaatacaaaaaa
tgggacggcacgcaccgtcccatttacgagacagacactgggagtaaataaagtatgcct
aagtaccgttccgccaccaccactcatggtcgtaatatggcgggtgctcgtgcgctgtgg
cgcgccaccggaatgaccgacgccgatttcggtaagccgattatcgcggttgtgaactcg
ttcacccaatttgtaccgggtcacgtccatctgcgcgatctcggtaaactggtcgccgaa
caaattgaagcggctggcggcgttgccaaagagttcaacaccattgcggtggatgatggg
attgccatgggccacggggggatgctttattcactgccatctcgcgaactgatcgctgat
tccgttgagtatatggtcaacgcccactgcgccgacgccatggtctgcatctctaactgt
gacaaaatcaccccggggatgctgatggcttccctgcgtctgaatattccggtgatcttt
gtttccggcg